EMAIL THIS PAGE TO A FRIEND

HPS4

Hermansky-Pudlak syndrome 4

74 Gene Product Result for
Synonyms: LE
Gene ID:
Human(89781) Summary: This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(192232) Hermansky-Pudlak syndrome 4 homolog (human)
Rat(304555) Hermansky-Pudlak syndrome 4
Zebrafish(393296) Hermansky-Pudlak syndrome 4
chicken(416907) Hermansky-Pudlak syndrome 4
dog(486330) Hermansky-Pudlak syndrome 4
fruit fly(37009) Hermansky-Pudlak Syndrome 4 ortholog
cow(615386) Hermansky-Pudlak syndrome 4
Horse(100059474) Hermansky-Pudlak syndrome 4
domestic cat(101083975) Hermansky-Pudlak syndrome 4
domestic guinea pig(100721935) Hermansky-Pudlak syndrome 4
naked mole-rat(101714464) Hermansky-Pudlak syndrome 4
sheep(101118387) Hermansky-Pudlak syndrome 4
Domestic Rabbit(100338186) Hermansky-Pudlak syndrome 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022081 Rosetta Predictions human pricing
NM_152841 Rosetta Predictions human pricing
NM_152843 Rosetta Predictions human pricing
NM_001107148 Rosetta Predictions rat pricing
NM_138646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355456 predicted 2272
2 SASI_Hs02_00355457 predicted 2590
3 SASI_Hs01_00129558 predicted 1137
4 SASI_Hs01_00129559 predicted 1011
5 SASI_Hs02_00355458 predicted 1418
6 SASI_Hs01_00129563 predicted 1731
7 SASI_Hs02_00355459 predicted 2469
8 SASI_Hs01_00129564 predicted 1755
9 SASI_Hs01_00129565 predicted 1080
10 SASI_Hs02_00355460 predicted 2057
11 SASI_Hs01_00129556 predicted 1646
12 SASI_Hs01_00129557 predicted 1025
13 SASI_Hs01_00129560 predicted 1047
14 SASI_Hs01_00129561 predicted 1141
15 SASI_Hs01_00129562 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366776 predicted 1800
2 SASI_Hs02_00366777 predicted 2120
3 SASI_Hs01_00095616 predicted 666
4 SASI_Hs01_00095617 predicted 538
5 SASI_Hs02_00366778 predicted 947
6 SASI_Hs01_00095621 predicted 1256
7 SASI_Hs02_00366779 predicted 1994
8 SASI_Hs01_00095622 predicted 1282
9 SASI_Hs01_00095623 predicted 606
10 SASI_Hs02_00366780 predicted 1584
11 SASI_Hs01_00095614 predicted 1176
12 SASI_Hs01_00095615 predicted 552
13 SASI_Hs01_00095618 predicted 572
14 SASI_Hs01_00095619 predicted 670
15 SASI_Hs01_00095620 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169233 predicted 1615
2 SASI_Hs01_00169234 predicted 926
3 SASI_Hs01_00169235 predicted 1048
4 SASI_Hs01_00169236 predicted 927
5 SASI_Hs01_00169237 predicted 951
6 SASI_Hs01_00169238 predicted 1050
7 SASI_Hs01_00169239 predicted 989
8 SASI_Hs01_00169240 predicted 1695
9 SASI_Hs01_00169241 predicted 1721
10 SASI_Hs01_00169242 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225975 predicted 1337
2 SASI_Rn02_00225976 predicted 1478
3 SASI_Rn02_00225977 predicted 1773
4 SASI_Rn02_00225978 predicted 1914
5 SASI_Rn02_00225979 predicted 1079
6 SASI_Rn02_00225980 predicted 1268
7 SASI_Rn02_00225981 predicted 1904
8 SASI_Rn02_00225982 predicted 1462
9 SASI_Rn02_00225983 predicted 1577
10 SASI_Rn02_00225984 predicted 2082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107602 predicted 856
2 SASI_Mm02_00339693 predicted 1000
3 SASI_Mm01_00107604 predicted 281
4 SASI_Mm02_00339694 predicted 508
5 SASI_Mm01_00107605 predicted 1994
6 SASI_Mm01_00107606 predicted 549
7 SASI_Mm01_00107607 predicted 1284
8 SASI_Mm01_00107608 predicted 2036
9 SASI_Mm01_00107609 predicted 634
10 SASI_Mm01_00107610 predicted 708
11 SASI_Mm01_00107601 predicted 628
12 SASI_Mm01_00107603 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022081
VALIDATED
HPS4 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-3682s1c1
Sequence:CCGGCCTCAGTTCTATTACGTTATACTCGAGTATAACGTAATAGAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1108s1c1
Sequence:CCGGCCAGTGATCTGCATAAGATTTCTCGAGAAATCTTATGCAGATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2270s1c1
Sequence:CCGGGCTCGTGAGGATGAATCTCTACTCGAGTAGAGATTCATCCTCACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2061s1c1
Sequence:CCGGCCCTTGTTATTGCCTCGCTTACTCGAGTAAGCGAGGCAATAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1107s1c1
Sequence:CCGGACCAGTGATCTGCATAAGATTCTCGAGAATCTTATGCAGATCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-720s21c1
Sequence:CCGGTATGATGGTTCCAAGGTAAAGCTCGAGCTTTACCTTGGAACCATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2598s21c1
Sequence:CCGGTATGAAATGACTGTCAGAAATCTCGAGATTTCTGACAGTCATTTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1020s21c1
Sequence:CCGGGGACCTGTTTCCCTAGCTTATCTCGAGATAAGCTAGGGAAACAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2559s21c1
Sequence:CCGGAGCCTGATGCATAGCGAATTTCTCGAGAAATTCGCTATGCATCAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1076s21c1
Sequence:CCGGGGACACCTTCATCGAGCAAATCTCGAGATTTGCTCGATGAAGGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-841s21c1
Sequence:CCGGTCCGCTGTGTTTCTGACATTTCTCGAGAAATGTCAGAAACACAGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022081
VALIDATED
HPS4 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-3682s1c1
Sequence:CCGGCCTCAGTTCTATTACGTTATACTCGAGTATAACGTAATAGAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1108s1c1
Sequence:CCGGCCAGTGATCTGCATAAGATTTCTCGAGAAATCTTATGCAGATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2270s1c1
Sequence:CCGGGCTCGTGAGGATGAATCTCTACTCGAGTAGAGATTCATCCTCACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2061s1c1
Sequence:CCGGCCCTTGTTATTGCCTCGCTTACTCGAGTAAGCGAGGCAATAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1107s1c1
Sequence:CCGGACCAGTGATCTGCATAAGATTCTCGAGAATCTTATGCAGATCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-720s21c1
Sequence:CCGGTATGATGGTTCCAAGGTAAAGCTCGAGCTTTACCTTGGAACCATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2598s21c1
Sequence:CCGGTATGAAATGACTGTCAGAAATCTCGAGATTTCTGACAGTCATTTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1020s21c1
Sequence:CCGGGGACCTGTTTCCCTAGCTTATCTCGAGATAAGCTAGGGAAACAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2559s21c1
Sequence:CCGGAGCCTGATGCATAGCGAATTTCTCGAGAAATTCGCTATGCATCAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1076s21c1
Sequence:CCGGGGACACCTTCATCGAGCAAATCTCGAGATTTGCTCGATGAAGGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-841s21c1
Sequence:CCGGTCCGCTGTGTTTCTGACATTTCTCGAGAAATGTCAGAAACACAGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022081
VALIDATED
HPS4 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-3682s1c1
Sequence:CCGGCCTCAGTTCTATTACGTTATACTCGAGTATAACGTAATAGAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1108s1c1
Sequence:CCGGCCAGTGATCTGCATAAGATTTCTCGAGAAATCTTATGCAGATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2270s1c1
Sequence:CCGGGCTCGTGAGGATGAATCTCTACTCGAGTAGAGATTCATCCTCACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-2061s1c1
Sequence:CCGGCCCTTGTTATTGCCTCGCTTACTCGAGTAAGCGAGGCAATAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022081.4-1107s1c1
Sequence:CCGGACCAGTGATCTGCATAAGATTCTCGAGAATCTTATGCAGATCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-720s21c1
Sequence:CCGGTATGATGGTTCCAAGGTAAAGCTCGAGCTTTACCTTGGAACCATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2598s21c1
Sequence:CCGGTATGAAATGACTGTCAGAAATCTCGAGATTTCTGACAGTCATTTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1020s21c1
Sequence:CCGGGGACCTGTTTCCCTAGCTTATCTCGAGATAAGCTAGGGAAACAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-2559s21c1
Sequence:CCGGAGCCTGATGCATAGCGAATTTCTCGAGAAATTCGCTATGCATCAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-1076s21c1
Sequence:CCGGGGACACCTTCATCGAGCAAATCTCGAGATTTGCTCGATGAAGGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022081.4-841s21c1
Sequence:CCGGTCCGCTGTGTTTCTGACATTTCTCGAGAAATGTCAGAAACACAGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138646
VALIDATED
HPS4 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2247s21c1
Sequence:CCGGTGGGTGCAGCTTGCATATCACCTCGAGGTGATATGCAAGCTGCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-681s1c1
Sequence:CCGGCGAATCGCACAGGATCTTCAACTCGAGTTGAAGATCCTGTGCGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-1917s1c1
Sequence:CCGGCACATACAACTTCCTTCATTACTCGAGTAATGAAGGAAGTTGTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-288s1c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138646.2-288s21c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2018s21c1
Sequence:CCGGACCTCATGCACTCCGACTTTGCTCGAGCAAAGTCGGAGTGCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1287s21c1
Sequence:CCGGGGAACTGGACTCGTCTGAAATCTCGAGATTTCAGACGAGTCCAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1053s21c1
Sequence:CCGGATACCCTCCCTGGGATCAAAGCTCGAGCTTTGATCCCAGGGAGGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138646
VALIDATED
HPS4 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2247s21c1
Sequence:CCGGTGGGTGCAGCTTGCATATCACCTCGAGGTGATATGCAAGCTGCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-681s1c1
Sequence:CCGGCGAATCGCACAGGATCTTCAACTCGAGTTGAAGATCCTGTGCGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-1917s1c1
Sequence:CCGGCACATACAACTTCCTTCATTACTCGAGTAATGAAGGAAGTTGTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-288s1c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138646.2-288s21c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2018s21c1
Sequence:CCGGACCTCATGCACTCCGACTTTGCTCGAGCAAAGTCGGAGTGCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1287s21c1
Sequence:CCGGGGAACTGGACTCGTCTGAAATCTCGAGATTTCAGACGAGTCCAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1053s21c1
Sequence:CCGGATACCCTCCCTGGGATCAAAGCTCGAGCTTTGATCCCAGGGAGGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138646
VALIDATED
HPS4 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2247s21c1
Sequence:CCGGTGGGTGCAGCTTGCATATCACCTCGAGGTGATATGCAAGCTGCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-681s1c1
Sequence:CCGGCGAATCGCACAGGATCTTCAACTCGAGTTGAAGATCCTGTGCGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-1917s1c1
Sequence:CCGGCACATACAACTTCCTTCATTACTCGAGTAATGAAGGAAGTTGTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138646.2-288s1c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138646.2-288s21c1
Sequence:CCGGGTATGACGGTTCCAAGGTAAACTCGAGTTTACCTTGGAACCGTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-2018s21c1
Sequence:CCGGACCTCATGCACTCCGACTTTGCTCGAGCAAAGTCGGAGTGCATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1287s21c1
Sequence:CCGGGGAACTGGACTCGTCTGAAATCTCGAGATTTCAGACGAGTCCAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138646.2-1053s21c1
Sequence:CCGGATACCCTCCCTGGGATCAAAGCTCGAGCTTTGATCCCAGGGAGGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)