EMAIL THIS PAGE TO A FRIEND

HPS5

Hermansky-Pudlak syndrome 5

134 Gene Product Result for
Synonyms: AIBP63
Gene ID:
Human(11234) Summary: This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(246694) Hermansky-Pudlak syndrome 5 homolog (human)
Rat(308598) Hermansky-Pudlak syndrome 5
sheep(101119945) Hermansky-Pudlak syndrome 5
Domestic Rabbit(100342492) Hermansky-Pudlak syndrome 5
domestic guinea pig(100716300) Hermansky-Pudlak syndrome 5
naked mole-rat(101714520) Hermansky-Pudlak syndrome 5
Zebrafish(100037388) Hermansky-Pudlak syndrome 5
chicken(423079) Hermansky-Pudlak syndrome 5
domestic cat(101099749) Hermansky-Pudlak syndrome 5
cow(510165) Hermansky-Pudlak syndrome 5
Horse(100071855) Hermansky-Pudlak syndrome 5
dog(485404) Hermansky-Pudlak syndrome 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101369 Anti-HPS5 (826-840) antibody produced in rabbit IgG fraction of antiserum human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007216 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068861 MISSION® esiRNA esiRNA human HPS5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007216 Rosetta Predictions human pricing
NM_181507 Rosetta Predictions human pricing
NM_181508 Rosetta Predictions human pricing
NM_001005247 Rosetta Predictions mouse pricing
NM_001005248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032479 predicted 1401
2 SASI_Hs02_00343211 predicted 1303
3 SASI_Hs01_00032480 predicted 2603
4 SASI_Hs01_00032481 predicted 2401
5 SASI_Hs02_00343212 predicted 865
6 SASI_Hs01_00032483 predicted 2946
7 SASI_Hs01_00032485 predicted 2617
8 SASI_Hs01_00032487 predicted 2928
9 SASI_Hs01_00032488 predicted 1223
10 SASI_Hs02_00343213 predicted 2105
11 SASI_Hs01_00032482 predicted 769
12 SASI_Hs01_00032484 predicted 1443
13 SASI_Hs01_00032486 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206054 predicted 1553
2 SASI_Hs02_00370127 predicted 1461
3 SASI_Hs01_00206055 predicted 2753
4 SASI_Hs01_00206056 predicted 2557
5 SASI_Hs02_00370128 predicted 1019
6 SASI_Hs01_00206058 predicted 3103
7 SASI_Hs01_00206060 predicted 2779
8 SASI_Hs01_00206062 predicted 3089
9 SASI_Hs01_00206063 predicted 1381
10 SASI_Hs02_00370129 predicted 2261
11 SASI_Hs01_00206057 predicted 932
12 SASI_Hs01_00206059 predicted 1593
13 SASI_Hs01_00206061 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024320 predicted 1205
2 SASI_Hs02_00370130 predicted 1113
3 SASI_Hs01_00024321 predicted 2410
4 SASI_Hs01_00024322 predicted 2213
5 SASI_Hs02_00370131 predicted 676
6 SASI_Hs01_00024324 predicted 2757
7 SASI_Hs01_00024326 predicted 2433
8 SASI_Hs01_00024328 predicted 2741
9 SASI_Hs01_00024329 predicted 1041
10 SASI_Hs02_00370132 predicted 1915
11 SASI_Hs01_00024323 predicted 589
12 SASI_Hs01_00024325 predicted 1251
13 SASI_Hs01_00024327 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102104 predicted 1684
2 SASI_Mm01_00102105 predicted 1140
3 SASI_Mm01_00102106 predicted 1173
4 SASI_Mm02_00286561 predicted 1916
5 SASI_Mm01_00102107 predicted 552
6 SASI_Mm01_00102108 predicted 3151
7 SASI_Mm01_00102109 predicted 2813
8 SASI_Mm01_00102110 predicted 1126
9 SASI_Mm01_00102111 predicted 1513
10 SASI_Mm01_00102112 predicted 3469
11 SASI_Mm01_00102113 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109656 predicted 1662
2 SASI_Mm01_00109657 predicted 1124
3 SASI_Mm01_00109658 predicted 1153
4 SASI_Mm02_00286562 predicted 1893
5 SASI_Mm01_00109659 predicted 529
6 SASI_Mm01_00109660 predicted 3125
7 SASI_Mm01_00109661 predicted 2789
8 SASI_Mm01_00109662 predicted 1104
9 SASI_Mm01_00109663 predicted 1485
10 SASI_Mm01_00109664 predicted 3447
11 SASI_Mm01_00109665 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005247
VALIDATED
HPS5 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005247.1-2823s21c1
Sequence:GTACCGGAGTCCCTTGTTGATTGCATTTCTCGAGAAATGCAATCAACAAGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-415s21c1
Sequence:GTACCGGGCATAGCTGTGTCTCGGAAATCTCGAGATTTCCGAGACACAGCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-593s21c1
Sequence:GTACCGGTGTAGTTGTTTGGGAATTAAACTCGAGTTTAATTCCCAAACAACTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-1679s21c1
Sequence:GTACCGGCAGTCAGTCCGACGAAGATTCCTCGAGGAATCTTCGTCGGACTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005247.1-2952s1c1
Sequence:CCGGGCTCAGTTCTTGGCCTATCTACTCGAGTAGATAGGCCAAGAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005247.1-1907s1c1
Sequence:CCGGCGTGTCTCTTCAGGCTGTTAACTCGAGTTAACAGCCTGAAGAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-3970s1c1
Sequence:CCGGGCTTTGGTACAGGAAGACATACTCGAGTATGTCTTCCTGTACCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-4396s1c1
Sequence:CCGGGCCTCCTGAATGTTAGAATTACTCGAGTAATTCTAACATTCAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005247
VALIDATED
HPS5 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005247.1-2823s21c1
Sequence:GTACCGGAGTCCCTTGTTGATTGCATTTCTCGAGAAATGCAATCAACAAGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-415s21c1
Sequence:GTACCGGGCATAGCTGTGTCTCGGAAATCTCGAGATTTCCGAGACACAGCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-593s21c1
Sequence:GTACCGGTGTAGTTGTTTGGGAATTAAACTCGAGTTTAATTCCCAAACAACTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-1679s21c1
Sequence:GTACCGGCAGTCAGTCCGACGAAGATTCCTCGAGGAATCTTCGTCGGACTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005247.1-2952s1c1
Sequence:CCGGGCTCAGTTCTTGGCCTATCTACTCGAGTAGATAGGCCAAGAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005247.1-1907s1c1
Sequence:CCGGCGTGTCTCTTCAGGCTGTTAACTCGAGTTAACAGCCTGAAGAGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-3970s1c1
Sequence:CCGGGCTTTGGTACAGGAAGACATACTCGAGTATGTCTTCCTGTACCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-4396s1c1
Sequence:CCGGGCCTCCTGAATGTTAGAATTACTCGAGTAATTCTAACATTCAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005247
VALIDATED
HPS5 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005247.1-2823s21c1
Sequence:GTACCGGAGTCCCTTGTTGATTGCATTTCTCGAGAAATGCAATCAACAAGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-415s21c1
Sequence:GTACCGGGCATAGCTGTGTCTCGGAAATCTCGAGATTTCCGAGACACAGCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-593s21c1
Sequence:GTACCGGTGTAGTTGTTTGGGAATTAAACTCGAGTTTAATTCCCAAACAACTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005247.1-1679s21c1
Sequence:GTACCGGCAGTCAGTCCGACGAAGATTCCTCGAGGAATCTTCGTCGGACTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005247.1-2952s1c1
Sequence:CCGGGCTCAGTTCTTGGCCTATCTACTCGAGTAGATAGGCCAAGAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005247.1-1907s1c1
Sequence:CCGGCGTGTCTCTTCAGGCTGTTAACTCGAGTTAACAGCCTGAAGAGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-3970s1c1
Sequence:CCGGGCTTTGGTACAGGAAGACATACTCGAGTATGTCTTCCTGTACCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005247.1-4396s1c1
Sequence:CCGGGCCTCCTGAATGTTAGAATTACTCGAGTAATTCTAACATTCAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007216
VALIDATED
HPS5 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2131s21c1
Sequence:GTACCGGCCAGGATGTGCTATTAGTTAACTCGAGTTAACTAATAGCACATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007216.3-3903s21c1
Sequence:CCGGCATGAAGACAGATGGTATTATCTCGAGATAATACCATCTGTCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2606s21c1
Sequence:CCGGGATCTACCAACAAGGTTAAAGCTCGAGCTTTAACCTTGTTGGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-1342s21c1
Sequence:CCGGTGGCACCTACAATGATCTAATCTCGAGATTAGATCATTGTAGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-654s21c1
Sequence:CCGGGTGTTGTACAGTTAGATTATTCTCGAGAATAATCTAACTGTACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-4449s1c1
Sequence:CCGGCCCACAAGAATCATGCACTTTCTCGAGAAAGTGCATGATTCTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1344s1c1
Sequence:CCGGGCACCTACAATGATCTAATTTCTCGAGAAATTAGATCATTGTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1431s1c1
Sequence:CCGGCCATTTCATCACATGAAAGTTCTCGAGAACTTTCATGTGATGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-510s1c1
Sequence:CCGGGCTGGGATACAGCTATTCTTACTCGAGTAAGAATAGCTGTATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-2329s1c1
Sequence:CCGGCCTGGCTGAATTGACAACATTCTCGAGAATGTTGTCAATTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007216
VALIDATED
HPS5 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2131s21c1
Sequence:GTACCGGCCAGGATGTGCTATTAGTTAACTCGAGTTAACTAATAGCACATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007216.3-3903s21c1
Sequence:CCGGCATGAAGACAGATGGTATTATCTCGAGATAATACCATCTGTCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2606s21c1
Sequence:CCGGGATCTACCAACAAGGTTAAAGCTCGAGCTTTAACCTTGTTGGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-1342s21c1
Sequence:CCGGTGGCACCTACAATGATCTAATCTCGAGATTAGATCATTGTAGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-654s21c1
Sequence:CCGGGTGTTGTACAGTTAGATTATTCTCGAGAATAATCTAACTGTACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-4449s1c1
Sequence:CCGGCCCACAAGAATCATGCACTTTCTCGAGAAAGTGCATGATTCTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1344s1c1
Sequence:CCGGGCACCTACAATGATCTAATTTCTCGAGAAATTAGATCATTGTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1431s1c1
Sequence:CCGGCCATTTCATCACATGAAAGTTCTCGAGAACTTTCATGTGATGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-510s1c1
Sequence:CCGGGCTGGGATACAGCTATTCTTACTCGAGTAAGAATAGCTGTATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-2329s1c1
Sequence:CCGGCCTGGCTGAATTGACAACATTCTCGAGAATGTTGTCAATTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007216
VALIDATED
HPS5 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2131s21c1
Sequence:GTACCGGCCAGGATGTGCTATTAGTTAACTCGAGTTAACTAATAGCACATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007216.3-3903s21c1
Sequence:CCGGCATGAAGACAGATGGTATTATCTCGAGATAATACCATCTGTCTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-2606s21c1
Sequence:CCGGGATCTACCAACAAGGTTAAAGCTCGAGCTTTAACCTTGTTGGTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-1342s21c1
Sequence:CCGGTGGCACCTACAATGATCTAATCTCGAGATTAGATCATTGTAGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007216.3-654s21c1
Sequence:CCGGGTGTTGTACAGTTAGATTATTCTCGAGAATAATCTAACTGTACAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-4449s1c1
Sequence:CCGGCCCACAAGAATCATGCACTTTCTCGAGAAAGTGCATGATTCTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1344s1c1
Sequence:CCGGGCACCTACAATGATCTAATTTCTCGAGAAATTAGATCATTGTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-1431s1c1
Sequence:CCGGCCATTTCATCACATGAAAGTTCTCGAGAACTTTCATGTGATGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-510s1c1
Sequence:CCGGGCTGGGATACAGCTATTCTTACTCGAGTAAGAATAGCTGTATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007216.3-2329s1c1
Sequence:CCGGCCTGGCTGAATTGACAACATTCTCGAGAATGTTGTCAATTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)