EMAIL THIS PAGE TO A FRIEND

HPS6

Hermansky-Pudlak syndrome 6

51 Gene Product Result for
Synonyms: RP11-302K17.1
UniProtKB ID: Q86YV9, Q5VV69, Q9H685
Gene ID:
Human(79803) Summary: This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
Mouse(20170) Hermansky-Pudlak syndrome 6
Rat(309446) Hermansky-Pudlak syndrome 6
chicken(770328) Hermansky-Pudlak syndrome 6
cow(511792) Hermansky-Pudlak syndrome 6
dog(609471) Hermansky-Pudlak syndrome 6
domestic cat(101100087) Hermansky-Pudlak syndrome 6
domestic guinea pig(100720545) Hermansky-Pudlak syndrome 6
naked mole-rat(101706231) Hermansky-Pudlak syndrome 6
sheep(101105705) Hermansky-Pudlak syndrome 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024747 Rosetta Predictions human pricing
NM_181432 Rosetta Predictions rat pricing
NM_176785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035287 predicted 2343
2 SASI_Hs01_00035288 predicted 618
3 SASI_Hs01_00035289 predicted 1978
4 SASI_Hs01_00035290 predicted 549
5 SASI_Hs02_00357233 predicted 1073
6 SASI_Hs01_00035291 predicted 738
7 SASI_Hs01_00035292 predicted 940
8 SASI_Hs01_00035293 predicted 2077
9 SASI_Hs01_00035294 predicted 1808
10 SASI_Hs02_00357234 predicted 2406
11 SASI_Hs01_00035285 predicted 2272
12 SASI_Hs01_00035286 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269738 predicted 1100
2 SASI_Rn01_00090773 predicted 901
3 SASI_Rn01_00090775 predicted 1439
4 SASI_Rn02_00269739 predicted 1347
5 SASI_Rn02_00269740 predicted 1757
6 SASI_Rn01_00090777 predicted 653
7 SASI_Rn01_00090778 predicted 1097
8 SASI_Rn01_00090780 predicted 919
9 SASI_Rn01_00090781 predicted 195
10 SASI_Rn01_00090782 predicted 1411
11 SASI_Rn01_00090774 predicted 346
12 SASI_Rn01_00090776 predicted 1912
13 SASI_Rn01_00090779 predicted 2346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131103 predicted 792
2 SASI_Mm01_00131104 predicted 2214
3 SASI_Mm01_00131105 predicted 1779
4 SASI_Mm01_00131106 predicted 2031
5 SASI_Mm01_00131107 predicted 1489
6 SASI_Mm01_00131108 predicted 809
7 SASI_Mm01_00131109 predicted 1502
8 SASI_Mm01_00131110 predicted 2374
9 SASI_Mm01_00131111 predicted 2237
10 SASI_Mm02_00346710 predicted 552
11 SASI_Mm01_00131112 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024747
VALIDATED
HPS6 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2492s1c1
Sequence:CCGGTCACTGACACAGGAAATCATTCTCGAGAATGATTTCCTGTGTCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-781s1c1
Sequence:CCGGGCTTGGTCTCTCCTACAGTAACTCGAGTTACTGTAGGAGAGACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2349s1c1
Sequence:CCGGGCCCATATGAGGACATCCTATCTCGAGATAGGATGTCCTCATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2080s1c1
Sequence:CCGGGCTTCGAAGTGAAATCTTCAACTCGAGTTGAAGATTTCACTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-1200s1c1
Sequence:CCGGGAGGGAATCTTCGTCTGCTTTCTCGAGAAAGCAGACGAAGATTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-1563s21c1
Sequence:CCGGTGCTGAGGACTGAGTTGATAGCTCGAGCTATCAACTCAGTCCTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-2198s21c1
Sequence:CCGGCTGCTTCTACTGAGGACATACCTCGAGGTATGTCCTCAGTAGAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024747.4-2493s21c1
Sequence:CCGGCACTGACACAGGAAATCATTTCTCGAGAAATGATTTCCTGTGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-2082s21c1
Sequence:CCGGTTCGAAGTGAAATCTTCAAACCTCGAGGTTTGAAGATTTCACTTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-782s21c1
Sequence:CCGGCTTGGTCTCTCCTACAGTAAGCTCGAGCTTACTGTAGGAGAGACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024747
VALIDATED
HPS6 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2492s1c1
Sequence:CCGGTCACTGACACAGGAAATCATTCTCGAGAATGATTTCCTGTGTCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-781s1c1
Sequence:CCGGGCTTGGTCTCTCCTACAGTAACTCGAGTTACTGTAGGAGAGACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2349s1c1
Sequence:CCGGGCCCATATGAGGACATCCTATCTCGAGATAGGATGTCCTCATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2080s1c1
Sequence:CCGGGCTTCGAAGTGAAATCTTCAACTCGAGTTGAAGATTTCACTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-1200s1c1
Sequence:CCGGGAGGGAATCTTCGTCTGCTTTCTCGAGAAAGCAGACGAAGATTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-1563s21c1
Sequence:CCGGTGCTGAGGACTGAGTTGATAGCTCGAGCTATCAACTCAGTCCTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-2198s21c1
Sequence:CCGGCTGCTTCTACTGAGGACATACCTCGAGGTATGTCCTCAGTAGAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024747.4-2493s21c1
Sequence:CCGGCACTGACACAGGAAATCATTTCTCGAGAAATGATTTCCTGTGTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-2082s21c1
Sequence:CCGGTTCGAAGTGAAATCTTCAAACCTCGAGGTTTGAAGATTTCACTTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-782s21c1
Sequence:CCGGCTTGGTCTCTCCTACAGTAAGCTCGAGCTTACTGTAGGAGAGACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024747
VALIDATED
HPS6 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2492s1c1
Sequence:CCGGTCACTGACACAGGAAATCATTCTCGAGAATGATTTCCTGTGTCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-781s1c1
Sequence:CCGGGCTTGGTCTCTCCTACAGTAACTCGAGTTACTGTAGGAGAGACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2349s1c1
Sequence:CCGGGCCCATATGAGGACATCCTATCTCGAGATAGGATGTCCTCATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-2080s1c1
Sequence:CCGGGCTTCGAAGTGAAATCTTCAACTCGAGTTGAAGATTTCACTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024747.4-1200s1c1
Sequence:CCGGGAGGGAATCTTCGTCTGCTTTCTCGAGAAAGCAGACGAAGATTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-1563s21c1
Sequence:CCGGTGCTGAGGACTGAGTTGATAGCTCGAGCTATCAACTCAGTCCTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-2198s21c1
Sequence:CCGGCTGCTTCTACTGAGGACATACCTCGAGGTATGTCCTCAGTAGAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024747.4-2493s21c1
Sequence:CCGGCACTGACACAGGAAATCATTTCTCGAGAAATGATTTCCTGTGTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024747.4-2082s21c1
Sequence:CCGGTTCGAAGTGAAATCTTCAAACCTCGAGGTTTGAAGATTTCACTTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024747.4-782s21c1
Sequence:CCGGCTTGGTCTCTCCTACAGTAAGCTCGAGCTTACTGTAGGAGAGACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176785
VALIDATED
HPS6 MISSION shRNA Bacterial Glycerol Stock
Hermansky-Pudlak syndrome 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1743s1c1
Sequence:CCGGGATGTATGGAAGAAGGTCCTACTCGAGTAGGACCTTCTTCCATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1780s1c1
Sequence:CCGGGAAAGGAACATCCCAATGGAACTCGAGTTCCATTGGGATGTTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1493s1c1
Sequence:CCGGGCTCCGGGATTATCGTAGTATCTCGAGATACTACGATAATCCCGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-2112s21c1
Sequence:CCGGTGCTTGGAAGTGAGATCTTTACTCGAGTAAAGATCTCACTTCCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-1493s21c1
Sequence:CCGGCTCCGGGATTATCGTAGTATACTCGAGTATACTACGATAATCCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-2020s21c1
Sequence:CCGGAGCCGTGCTACAAGCTGTAAGCTCGAGCTTACAGCTTGTAGCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-1162s21c1
Sequence:CCGGCAGTACAGACAGAGTACATTTCTCGAGAAATGTACTCTGTCTGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-237s21c1
Sequence:CCGGGCCGCCACTTGCTGCTATTAACTCGAGTTAATAGCAGCAAGTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176785
VALIDATED
HPS6 MISSION shRNA shRNA Plasmid DNA
Hermansky-Pudlak syndrome 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1743s1c1
Sequence:CCGGGATGTATGGAAGAAGGTCCTACTCGAGTAGGACCTTCTTCCATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1780s1c1
Sequence:CCGGGAAAGGAACATCCCAATGGAACTCGAGTTCCATTGGGATGTTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1493s1c1
Sequence:CCGGGCTCCGGGATTATCGTAGTATCTCGAGATACTACGATAATCCCGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-2112s21c1
Sequence:CCGGTGCTTGGAAGTGAGATCTTTACTCGAGTAAAGATCTCACTTCCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-1493s21c1
Sequence:CCGGCTCCGGGATTATCGTAGTATACTCGAGTATACTACGATAATCCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-2020s21c1
Sequence:CCGGAGCCGTGCTACAAGCTGTAAGCTCGAGCTTACAGCTTGTAGCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-1162s21c1
Sequence:CCGGCAGTACAGACAGAGTACATTTCTCGAGAAATGTACTCTGTCTGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-237s21c1
Sequence:CCGGGCCGCCACTTGCTGCTATTAACTCGAGTTAATAGCAGCAAGTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176785
VALIDATED
HPS6 MISSION shRNA Lentiviral Transduction Particles
Hermansky-Pudlak syndrome 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1743s1c1
Sequence:CCGGGATGTATGGAAGAAGGTCCTACTCGAGTAGGACCTTCTTCCATACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1780s1c1
Sequence:CCGGGAAAGGAACATCCCAATGGAACTCGAGTTCCATTGGGATGTTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176785.1-1493s1c1
Sequence:CCGGGCTCCGGGATTATCGTAGTATCTCGAGATACTACGATAATCCCGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-2112s21c1
Sequence:CCGGTGCTTGGAAGTGAGATCTTTACTCGAGTAAAGATCTCACTTCCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-1493s21c1
Sequence:CCGGCTCCGGGATTATCGTAGTATACTCGAGTATACTACGATAATCCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-2020s21c1
Sequence:CCGGAGCCGTGCTACAAGCTGTAAGCTCGAGCTTACAGCTTGTAGCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176785.2-1162s21c1
Sequence:CCGGCAGTACAGACAGAGTACATTTCTCGAGAAATGTACTCTGTCTGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176785.2-237s21c1
Sequence:CCGGGCCGCCACTTGCTGCTATTAACTCGAGTTAATAGCAGCAAGTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)