EMAIL THIS PAGE TO A FRIEND

HPSE2

heparanase 2

81 Gene Product Result for
Synonyms: HPA2 HPR2 UFS UFS1
Gene ID:
Human(60495) Summary: This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(545291) heparanase 2
Rat(368128) heparanase 2
Zebrafish(562573) heparanase 2
cow(537343) heparanase 2
Horse(100070602) heparanase 2
dog(486831) heparanase 2
chicken(423834) heparanase 2
sheep(101117891) heparanase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068351 MISSION® esiRNA esiRNA human HPSE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021828 Rosetta Predictions human pricing
XM_001055916 Rosetta Predictions rat pricing
XM_347296 Rosetta Predictions rat pricing
NM_001081257 Rosetta Predictions mouse pricing
XM_619590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355143 predicted 792
2 SASI_Hs01_00074133 predicted 233
3 SASI_Hs01_00074135 predicted 1221
4 SASI_Hs01_00074136 predicted 952
5 SASI_Hs01_00074137 predicted 863
6 SASI_Hs01_00074138 predicted 1470
7 SASI_Hs01_00074139 predicted 1307
8 SASI_Hs01_00074140 predicted 833
9 SASI_Hs02_00355144 predicted 1556
10 SASI_Hs01_00074141 predicted 766
11 SASI_Hs01_00074134 predicted 1834
12 SASI_Hs01_00074142 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281399 predicted 1248
2 SASI_Rn02_00281400 predicted 1314
3 SASI_Rn02_00281401 predicted 1417
4 SASI_Rn02_00281402 predicted 754
5 SASI_Rn02_00281403 predicted 270
6 SASI_Rn02_00281404 predicted 769
7 SASI_Rn02_00281405 predicted 1231
8 SASI_Rn02_00281406 predicted 1203
9 SASI_Rn02_00281407 predicted 576
10 SASI_Rn02_00281408 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399636 predicted 1243
2 SASI_Rn02_00399637 predicted 1313
3 SASI_Rn02_00399638 predicted 1419
4 SASI_Rn02_00399639 predicted 748
5 SASI_Rn02_00399640 predicted 271
6 SASI_Rn02_00399641 predicted 778
7 SASI_Rn02_00399642 predicted 1226
8 SASI_Rn02_00399643 predicted 1203
9 SASI_Rn02_00399644 predicted 1499
10 SASI_Rn02_00399645 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296707 predicted 1250
2 SASI_Mm02_00296708 predicted 746
3 SASI_Mm02_00296709 predicted 1226
4 SASI_Mm02_00296710 predicted 269
5 SASI_Mm02_00296711 predicted 582
6 SASI_Mm02_00296712 predicted 1310
7 SASI_Mm02_00296713 predicted 802
8 SASI_Mm02_00296714 predicted 776
9 SASI_Mm02_00296715 predicted 596
10 SASI_Mm02_00296716 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226510 predicted 1247
2 SASI_Mm01_00226511 predicted 753
3 SASI_Mm01_00226512 predicted 1227
4 SASI_Mm01_00226513 predicted 279
5 SASI_Mm01_00226514 predicted 590
6 SASI_Mm01_00226515 predicted 1324
7 SASI_Mm01_00226516 predicted 774
8 SASI_Mm01_00226517 predicted 598
9 SASI_Mm01_00226518 predicted 614
10 SASI_Mm01_00226519 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021828
HPSE2 MISSION shRNA Bacterial Glycerol Stock
heparanase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-517s1c1
Sequence:CCGGCGAAGTGATGTTGCCTTAGATCTCGAGATCTAAGGCAACATCACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-518s1c1
Sequence:CCGGGAAGTGATGTTGCCTTAGATACTCGAGTATCTAAGGCAACATCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021828.2-1980s1c1
Sequence:CCGGCCAAAGAGACTAAATGTCATACTCGAGTATGACATTTAGTCTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-1226s1c1
Sequence:CCGGGCACAAACAATCTATCCGATTCTCGAGAATCGGATAGATTGTTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-1322s21c1
Sequence:CCGGGTCGTGATACGGCACTCATTTCTCGAGAAATGAGTGCCGTATCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-972s21c1
Sequence:CCGGGCTTATATGGCCCTAATATTGCTCGAGCAATATTAGGGCCATATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021828
HPSE2 MISSION shRNA shRNA Plasmid DNA
heparanase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-517s1c1
Sequence:CCGGCGAAGTGATGTTGCCTTAGATCTCGAGATCTAAGGCAACATCACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-518s1c1
Sequence:CCGGGAAGTGATGTTGCCTTAGATACTCGAGTATCTAAGGCAACATCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021828.2-1980s1c1
Sequence:CCGGCCAAAGAGACTAAATGTCATACTCGAGTATGACATTTAGTCTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-1226s1c1
Sequence:CCGGGCACAAACAATCTATCCGATTCTCGAGAATCGGATAGATTGTTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-1322s21c1
Sequence:CCGGGTCGTGATACGGCACTCATTTCTCGAGAAATGAGTGCCGTATCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-972s21c1
Sequence:CCGGGCTTATATGGCCCTAATATTGCTCGAGCAATATTAGGGCCATATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021828
HPSE2 MISSION shRNA Lentiviral Transduction Particles
heparanase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-517s1c1
Sequence:CCGGCGAAGTGATGTTGCCTTAGATCTCGAGATCTAAGGCAACATCACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-518s1c1
Sequence:CCGGGAAGTGATGTTGCCTTAGATACTCGAGTATCTAAGGCAACATCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021828.2-1980s1c1
Sequence:CCGGCCAAAGAGACTAAATGTCATACTCGAGTATGACATTTAGTCTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021828.2-1226s1c1
Sequence:CCGGGCACAAACAATCTATCCGATTCTCGAGAATCGGATAGATTGTTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-1322s21c1
Sequence:CCGGGTCGTGATACGGCACTCATTTCTCGAGAAATGAGTGCCGTATCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021828.4-972s21c1
Sequence:CCGGGCTTATATGGCCCTAATATTGCTCGAGCAATATTAGGGCCATATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081257
HPSE2 MISSION shRNA Bacterial Glycerol Stock
heparanase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-987s21c1
Sequence:CCGGTGCGGTTACCTGGCAACATTGCTCGAGCAATGTTGCCAGGTAACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-586s21c1
Sequence:CCGGACTTACAGTAACCTCATATTACTCGAGTAATATGAGGTTACTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1308s21c1
Sequence:CCGGTAACCCATTACCAGACTATTGCTCGAGCAATAGTCTGGTAATGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1588s21c1
Sequence:CCGGTATGGGCAGGAAGGCCTAAAGCTCGAGCTTTAGGCCTTCCTGCCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081257.1-1836s21c1
Sequence:CCGGACACACGTAGCGTCCTTATTCCTCGAGGAATAAGGACGCTACGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081257
HPSE2 MISSION shRNA shRNA Plasmid DNA
heparanase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-987s21c1
Sequence:CCGGTGCGGTTACCTGGCAACATTGCTCGAGCAATGTTGCCAGGTAACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-586s21c1
Sequence:CCGGACTTACAGTAACCTCATATTACTCGAGTAATATGAGGTTACTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1308s21c1
Sequence:CCGGTAACCCATTACCAGACTATTGCTCGAGCAATAGTCTGGTAATGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1588s21c1
Sequence:CCGGTATGGGCAGGAAGGCCTAAAGCTCGAGCTTTAGGCCTTCCTGCCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081257.1-1836s21c1
Sequence:CCGGACACACGTAGCGTCCTTATTCCTCGAGGAATAAGGACGCTACGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081257
HPSE2 MISSION shRNA Lentiviral Transduction Particles
heparanase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-987s21c1
Sequence:CCGGTGCGGTTACCTGGCAACATTGCTCGAGCAATGTTGCCAGGTAACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-586s21c1
Sequence:CCGGACTTACAGTAACCTCATATTACTCGAGTAATATGAGGTTACTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1308s21c1
Sequence:CCGGTAACCCATTACCAGACTATTGCTCGAGCAATAGTCTGGTAATGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081257.1-1588s21c1
Sequence:CCGGTATGGGCAGGAAGGCCTAAAGCTCGAGCTTTAGGCCTTCCTGCCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081257.1-1836s21c1
Sequence:CCGGACACACGTAGCGTCCTTATTCCTCGAGGAATAAGGACGCTACGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)