EMAIL THIS PAGE TO A FRIEND

HPSE

heparanase

62 Gene Product Result for
Synonyms: HPA HPA1 HPR1 HPSE1 HSE1
Gene ID:
Human(10855) Summary: Heparan sulfate proteoglycans are major components of the basement membrane and extracellular matrix. The protein encoded by this gene is an enzyme that cleaves heparan sulfate proteoglycans to permit cell movement through remodeling of the extracellular matrix. In addition, this cleavage can release bioactive molecules from the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(15442) heparanase
Rat(64537) heparanase
sheep(101118612) heparanase
Zebrafish(563020) heparanase
cow(281230) heparanase
Horse(100061267) heparanase
dog(608707) heparanase
chicken(373981) heparanase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006665 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098540 Rosetta Predictions human pricing
NM_006665 Rosetta Predictions human pricing
NM_022605 Rosetta Predictions rat pricing
NM_152803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319426 predicted 780
2 SASI_Hs02_00319427 predicted 1168
3 SASI_Hs02_00319428 predicted 1428
4 SASI_Hs02_00319429 predicted 850
5 SASI_Hs02_00319430 predicted 758
6 SASI_Hs02_00319431 predicted 1376
7 SASI_Hs02_00319432 predicted 683
8 SASI_Hs02_00319433 predicted 435
9 SASI_Hs02_00319434 predicted 1243
10 SASI_Hs02_00319435 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224895 predicted 817
2 SASI_Hs01_00224896 predicted 1206
3 SASI_Hs01_00224899 predicted 1459
4 SASI_Hs01_00224900 predicted 893
5 SASI_Hs01_00224901 predicted 798
6 SASI_Hs02_00342053 predicted 1419
7 SASI_Hs01_00224902 predicted 722
8 SASI_Hs01_00224903 predicted 473
9 SASI_Hs02_00342054 predicted 1274
10 SASI_Hs02_00342055 predicted 371
11 SASI_Hs01_00224897 predicted 1008
12 SASI_Hs01_00224898 predicted 1485
13 SASI_Hs01_00224904 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057682 predicted 575
2 SASI_Rn01_00057683 predicted 1604
3 SASI_Rn01_00057684 predicted 602
4 SASI_Rn01_00057685 predicted 1724
5 SASI_Rn01_00057686 predicted 385
6 SASI_Rn01_00057687 predicted 1323
7 SASI_Rn01_00057688 predicted 1244
8 SASI_Rn01_00057689 predicted 1508
9 SASI_Rn01_00057690 predicted 500
10 SASI_Rn01_00057691 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185582 predicted 406
2 SASI_Mm01_00185583 predicted 1131
3 SASI_Mm01_00185584 predicted 731
4 SASI_Mm01_00185586 predicted 1261
5 SASI_Mm02_00342803 predicted 786
6 SASI_Mm02_00342804 predicted 376
7 SASI_Mm01_00185587 predicted 1223
8 SASI_Mm01_00185588 predicted 1357
9 SASI_Mm01_00185589 predicted 319
10 SASI_Mm01_00185591 predicted 779
11 SASI_Mm01_00185585 predicted 1538
12 SASI_Mm01_00185590 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152803
HPSE MISSION shRNA Bacterial Glycerol Stock
heparanase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152803.2-1977s1c1
Sequence:CCGGAGGCAAATAAGTGGAGGATATCTCGAGATATCCTCCACTTATTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1518s1c1
Sequence:CCGGGCCGGATGGATTACTTTCCAACTCGAGTTGGAAAGTAATCCATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-687s1c1
Sequence:CCGGCCTTGACTACTGCTCTTCCAACTCGAGTTGGAAGAGCAGTAGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1393s1c1
Sequence:CCGGCCACGATATCAGGAAGGAGATCTCGAGATCTCCTTCCTGATATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1520s1c1
Sequence:CCGGCGGATGGATTACTTTCCAAATCTCGAGATTTGGAAAGTAATCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152803
HPSE MISSION shRNA shRNA Plasmid DNA
heparanase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152803.2-1977s1c1
Sequence:CCGGAGGCAAATAAGTGGAGGATATCTCGAGATATCCTCCACTTATTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1518s1c1
Sequence:CCGGGCCGGATGGATTACTTTCCAACTCGAGTTGGAAAGTAATCCATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-687s1c1
Sequence:CCGGCCTTGACTACTGCTCTTCCAACTCGAGTTGGAAGAGCAGTAGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1393s1c1
Sequence:CCGGCCACGATATCAGGAAGGAGATCTCGAGATCTCCTTCCTGATATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1520s1c1
Sequence:CCGGCGGATGGATTACTTTCCAAATCTCGAGATTTGGAAAGTAATCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152803
HPSE MISSION shRNA Lentiviral Transduction Particles
heparanase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152803.2-1977s1c1
Sequence:CCGGAGGCAAATAAGTGGAGGATATCTCGAGATATCCTCCACTTATTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1518s1c1
Sequence:CCGGGCCGGATGGATTACTTTCCAACTCGAGTTGGAAAGTAATCCATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-687s1c1
Sequence:CCGGCCTTGACTACTGCTCTTCCAACTCGAGTTGGAAGAGCAGTAGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1393s1c1
Sequence:CCGGCCACGATATCAGGAAGGAGATCTCGAGATCTCCTTCCTGATATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152803.2-1520s1c1
Sequence:CCGGCGGATGGATTACTTTCCAAATCTCGAGATTTGGAAAGTAATCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006665
HPSE MISSION shRNA Bacterial Glycerol Stock
heparanase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-704s1c1
Sequence:CCGGGCGTTATTAAGAACAGCAGATCTCGAGATCTGCTGTTCTTAATAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-819s1c1
Sequence:CCGGGTTTCCTTAAGAAGGCTGATACTCGAGTATCAGCCTTCTTAAGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-1931s1c1
Sequence:CCGGGCTAGGTAGAACACTGCTAATCTCGAGATTAGCAGTGTTCTACCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006665.2-2437s1c1
Sequence:CCGGGCGAGGAGATTCTGTAAACTTCTCGAGAAGTTTACAGAATCTCCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-452s1c1
Sequence:CCGGCCCAAGAAGGAATCAACCTTTCTCGAGAAAGGTTGATTCCTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-545s1c1
Sequence:CCGGGAGGAGAAGTTACGGTTGGAACTCGAGTTCCAACCGTAACTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1746s1c1
Sequence:CCGGCCAAAGTTGCTGCTTGCATCTCTCGAGAGATGCAAGCAGCAACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-2644s1c1
Sequence:CCGGCCCACATAACTAGACGTTCAACTCGAGTTGAACGTCTAGTTATGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1507s1c1
Sequence:CCGGCCATAATGTCACCAAGTACTTCTCGAGAAGTACTTGGTGACATTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006665
HPSE MISSION shRNA shRNA Plasmid DNA
heparanase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-704s1c1
Sequence:CCGGGCGTTATTAAGAACAGCAGATCTCGAGATCTGCTGTTCTTAATAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-819s1c1
Sequence:CCGGGTTTCCTTAAGAAGGCTGATACTCGAGTATCAGCCTTCTTAAGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-1931s1c1
Sequence:CCGGGCTAGGTAGAACACTGCTAATCTCGAGATTAGCAGTGTTCTACCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006665.2-2437s1c1
Sequence:CCGGGCGAGGAGATTCTGTAAACTTCTCGAGAAGTTTACAGAATCTCCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-452s1c1
Sequence:CCGGCCCAAGAAGGAATCAACCTTTCTCGAGAAAGGTTGATTCCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-545s1c1
Sequence:CCGGGAGGAGAAGTTACGGTTGGAACTCGAGTTCCAACCGTAACTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1746s1c1
Sequence:CCGGCCAAAGTTGCTGCTTGCATCTCTCGAGAGATGCAAGCAGCAACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-2644s1c1
Sequence:CCGGCCCACATAACTAGACGTTCAACTCGAGTTGAACGTCTAGTTATGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1507s1c1
Sequence:CCGGCCATAATGTCACCAAGTACTTCTCGAGAAGTACTTGGTGACATTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006665
HPSE MISSION shRNA Lentiviral Transduction Particles
heparanase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-704s1c1
Sequence:CCGGGCGTTATTAAGAACAGCAGATCTCGAGATCTGCTGTTCTTAATAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-819s1c1
Sequence:CCGGGTTTCCTTAAGAAGGCTGATACTCGAGTATCAGCCTTCTTAAGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-1931s1c1
Sequence:CCGGGCTAGGTAGAACACTGCTAATCTCGAGATTAGCAGTGTTCTACCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006665.2-2437s1c1
Sequence:CCGGGCGAGGAGATTCTGTAAACTTCTCGAGAAGTTTACAGAATCTCCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-452s1c1
Sequence:CCGGCCCAAGAAGGAATCAACCTTTCTCGAGAAAGGTTGATTCCTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006665.2-545s1c1
Sequence:CCGGGAGGAGAAGTTACGGTTGGAACTCGAGTTCCAACCGTAACTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1746s1c1
Sequence:CCGGCCAAAGTTGCTGCTTGCATCTCTCGAGAGATGCAAGCAGCAACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006665.2-2644s1c1
Sequence:CCGGCCCACATAACTAGACGTTCAACTCGAGTTGAACGTCTAGTTATGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006665.2-1507s1c1
Sequence:CCGGCCATAATGTCACCAAGTACTTCTCGAGAAGTACTTGGTGACATTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)