EMAIL THIS PAGE TO A FRIEND

HPX

hemopexin

57 Gene Product Result for
Synonyms: HX
UniProtKB ID: P02790, B2R957
Gene ID:
Human(3263) Summary: This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
Mouse(15458) hemopexin
Rat(58917) hemopexin
sheep(101117872) hemopexin
Zebrafish(327588) hemopexin
chicken(419076) hemopexin
dog(610982) hemopexin
cow(534509) hemopexin
Horse(100055123) hemopexin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0512 AQUA Peptide NFPSPVDAAF[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000613 Rosetta Predictions human pricing
NM_053318 Rosetta Predictions rat pricing
NM_017371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014874 predicted 1102
2 SASI_Hs01_00014875 predicted 310
3 SASI_Hs01_00014876 predicted 825
4 SASI_Hs01_00014877 predicted 1052
5 SASI_Hs01_00014878 predicted 987
6 SASI_Hs01_00014880 predicted 383
7 SASI_Hs01_00014881 predicted 460
8 SASI_Hs01_00014883 predicted 1093
9 SASI_Hs02_00302930 predicted 296
10 SASI_Hs02_00302931 predicted 833
11 SASI_Hs01_00014879 predicted 1077
12 SASI_Hs01_00014882 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038259 predicted 1069
2 SASI_Rn01_00038260 predicted 208
3 SASI_Rn01_00038261 predicted 1260
4 SASI_Rn02_00265745 predicted 409
5 SASI_Rn01_00038262 predicted 762
6 SASI_Rn01_00038263 predicted 767
7 SASI_Rn01_00038264 predicted 392
8 SASI_Rn01_00038266 predicted 845
9 SASI_Rn01_00038267 predicted 1183
10 SASI_Rn01_00038268 predicted 751
11 SASI_Rn01_00038265 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086912 predicted 1023
2 SASI_Mm01_00086913 predicted 761
3 SASI_Mm01_00086914 predicted 1002
4 SASI_Mm01_00086915 predicted 411
5 SASI_Mm01_00086916 predicted 776
6 SASI_Mm01_00086917 predicted 1084
7 SASI_Mm01_00086918 predicted 271
8 SASI_Mm01_00086919 predicted 1018
9 SASI_Mm01_00086920 predicted 757
10 SASI_Mm02_00323852 predicted 901
11 SASI_Mm01_00086921 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000613
HPX MISSION shRNA Bacterial Glycerol Stock
hemopexin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1134s21c1
Sequence:CCGGACTCTGTGGATGCGGCCTTTACTCGAGTAAAGGCCGCATCCACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1339s21c1
Sequence:CCGGCCTCATCCATGGTCCCAATTTCTCGAGAAATTGGGACCATGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1162s21c1
Sequence:CCGGTGGGTCTTCTCGGCTCCATATCTCGAGATATGGAGCCGAGAAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-752s1c1
Sequence:CCGGGCCCTGAGTATATGCGCTGTACTCGAGTACAGCGCATATACTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-247s1c1
Sequence:CCGGCGGGAGTTAATCTCAGAGAGACTCGAGTCTCTCTGAGATTAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-307s1c1
Sequence:CCGGCAAGGTCACAACAGTGTCTTTCTCGAGAAAGACACTGTTGTGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-385s1c1
Sequence:CCGGCCAAAGTTGCTCCAAGATGAACTCGAGTTCATCTTGGAGCAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-995s1c1
Sequence:CCGGAGGGAGGCTATACCCTAGTAACTCGAGTTACTAGGGTATAGCCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000613
HPX MISSION shRNA shRNA Plasmid DNA
hemopexin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1134s21c1
Sequence:CCGGACTCTGTGGATGCGGCCTTTACTCGAGTAAAGGCCGCATCCACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1339s21c1
Sequence:CCGGCCTCATCCATGGTCCCAATTTCTCGAGAAATTGGGACCATGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1162s21c1
Sequence:CCGGTGGGTCTTCTCGGCTCCATATCTCGAGATATGGAGCCGAGAAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-752s1c1
Sequence:CCGGGCCCTGAGTATATGCGCTGTACTCGAGTACAGCGCATATACTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-247s1c1
Sequence:CCGGCGGGAGTTAATCTCAGAGAGACTCGAGTCTCTCTGAGATTAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-307s1c1
Sequence:CCGGCAAGGTCACAACAGTGTCTTTCTCGAGAAAGACACTGTTGTGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-385s1c1
Sequence:CCGGCCAAAGTTGCTCCAAGATGAACTCGAGTTCATCTTGGAGCAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-995s1c1
Sequence:CCGGAGGGAGGCTATACCCTAGTAACTCGAGTTACTAGGGTATAGCCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000613
HPX MISSION shRNA Lentiviral Transduction Particles
hemopexin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1134s21c1
Sequence:CCGGACTCTGTGGATGCGGCCTTTACTCGAGTAAAGGCCGCATCCACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1339s21c1
Sequence:CCGGCCTCATCCATGGTCCCAATTTCTCGAGAAATTGGGACCATGGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000613.2-1162s21c1
Sequence:CCGGTGGGTCTTCTCGGCTCCATATCTCGAGATATGGAGCCGAGAAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-752s1c1
Sequence:CCGGGCCCTGAGTATATGCGCTGTACTCGAGTACAGCGCATATACTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-247s1c1
Sequence:CCGGCGGGAGTTAATCTCAGAGAGACTCGAGTCTCTCTGAGATTAACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-307s1c1
Sequence:CCGGCAAGGTCACAACAGTGTCTTTCTCGAGAAAGACACTGTTGTGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-385s1c1
Sequence:CCGGCCAAAGTTGCTCCAAGATGAACTCGAGTTCATCTTGGAGCAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000613.1-995s1c1
Sequence:CCGGAGGGAGGCTATACCCTAGTAACTCGAGTTACTAGGGTATAGCCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017371
VALIDATED
HPX MISSION shRNA Bacterial Glycerol Stock
hemopexin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1299s21c1
Sequence:CCGGTTTATCCATGGGCCCAATTTGCTCGAGCAAATTGGGCCCATGGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-206s21c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-150s21c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1007s21c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1329s21c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-130s1c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-1309s1c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-186s1c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-987s1c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017371
VALIDATED
HPX MISSION shRNA shRNA Plasmid DNA
hemopexin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1299s21c1
Sequence:CCGGTTTATCCATGGGCCCAATTTGCTCGAGCAAATTGGGCCCATGGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-206s21c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-150s21c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1007s21c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1329s21c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-130s1c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-1309s1c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-186s1c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-987s1c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017371
VALIDATED
HPX MISSION shRNA Lentiviral Transduction Particles
hemopexin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1299s21c1
Sequence:CCGGTTTATCCATGGGCCCAATTTGCTCGAGCAAATTGGGCCCATGGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-206s21c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017371.2-150s21c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1007s21c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017371.2-1329s21c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-130s1c1
Sequence:CCGGCCAGATTCAGATGTACCCGAACTCGAGTTCGGGTACATCTGAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-1309s1c1
Sequence:CCGGAGCAGTATAGACAAACTGAATCTCGAGATTCAGTTTGTCTATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-186s1c1
Sequence:CCGGCATGGATCACAATGGGACCATCTCGAGATGGTCCCATTGTGATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017371.1-987s1c1
Sequence:CCGGCCTGACAAAGGGAGGCAATAACTCGAGTTATTGCCTCCCTTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)