EMAIL THIS PAGE TO A FRIEND

HR

hair growth associated

84 Gene Product Result for
Synonyms: ALUNC AU HSA277165 MUHH MUHH1
UniProtKB ID: O43593, Q6GS30, Q96H33, Q9NPE1
Gene ID:
Human(55806) Summary: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by multiple regulatory ORFs that exist upstream of the primary ORF. Mutations in one of these upstream ORFs, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss. Mutations in this gene also cause autosomal recessive congenital alopecia and atrichia with papular lesions, other diseases resulting in hair loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(15460) hairless
Rat(60563) hair growth associated
cow(785815) hairless homolog (mouse)
dog(486130) hairless homolog (mouse)
domestic cat(101090097) hairless homolog (mouse)
Horse(100053727) hairless homolog (mouse)
domestic guinea pig(100726903) hair growth associated
naked mole-rat(101710794) hair growth associated
sheep(443241) hairless homolog (mouse)
Domestic Rabbit(100357019) hairless homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005144 Rosetta Predictions human pricing
NM_018411 Rosetta Predictions human pricing
NM_024364 Rosetta Predictions rat pricing
NM_021877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120213 predicted 1194
2 SASI_Hs01_00120214 predicted 2412
3 SASI_Hs02_00339078 predicted 605
4 SASI_Hs01_00120216 predicted 2307
5 SASI_Hs01_00120217 predicted 3955
6 SASI_Hs02_00339079 predicted 4128
7 SASI_Hs01_00120218 predicted 503
8 SASI_Hs02_00339080 predicted 1774
9 SASI_Hs01_00120219 predicted 3008
10 SASI_Hs01_00120220 predicted 2574
11 SASI_Hs01_00120212 predicted 802
12 SASI_Hs01_00120215 predicted 4037
13 SASI_Hs01_00120221 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048891 predicted 1188
2 SASI_Hs01_00048892 predicted 2413
3 SASI_Hs02_00351916 predicted 609
4 SASI_Hs01_00048894 predicted 2306
5 SASI_Hs01_00048895 predicted 3792
6 SASI_Hs02_00351917 predicted 3963
7 SASI_Hs01_00048896 predicted 502
8 SASI_Hs02_00351918 predicted 1770
9 SASI_Hs01_00048897 predicted 3009
10 SASI_Hs01_00048898 predicted 2577
11 SASI_Hs01_00048890 predicted 806
12 SASI_Hs01_00048893 predicted 3872
13 SASI_Hs01_00048899 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060973 predicted 1345
2 SASI_Rn01_00060974 predicted 3821
3 SASI_Rn02_00263948 predicted 1980
4 SASI_Rn02_00263949 predicted 2250
5 SASI_Rn01_00060976 predicted 3173
6 SASI_Rn01_00060977 predicted 2025
7 SASI_Rn01_00060978 predicted 2824
8 SASI_Rn01_00060979 predicted 1487
9 SASI_Rn01_00060980 predicted 1231
10 SASI_Rn01_00060981 predicted 973
11 SASI_Rn01_00060972 predicted 4061
12 SASI_Rn01_00060975 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200500 predicted 1691
2 SASI_Mm01_00200501 predicted 4062
3 SASI_Mm01_00200502 predicted 2035
4 SASI_Mm02_00326436 predicted 3052
5 SASI_Mm01_00200503 predicted 3066
6 SASI_Mm01_00200504 predicted 1576
7 SASI_Mm01_00200505 predicted 2494
8 SASI_Mm01_00200506 predicted 2737
9 SASI_Mm01_00200507 predicted 3066
10 SASI_Mm01_00200509 predicted 3053
11 SASI_Mm01_00200508 predicted 2568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021877
HR MISSION shRNA Bacterial Glycerol Stock
hair growth associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021877.2-4346s1c1
Sequence:CCGGCCGTTCTACAAATATCTCTTTCTCGAGAAAGAGATATTTGTAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-4162s1c1
Sequence:CCGGCCGTATGCTTTATGCCCAGATCTCGAGATCTGGGCATAAAGCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2314s1c1
Sequence:CCGGCCCAGAAGCTTCACTCAACAACTCGAGTTGTTGAGTGAAGCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2963s1c1
Sequence:CCGGCTAGCCTCTACTGCTGTCAAACTCGAGTTTGACAGCAGTAGAGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-3085s1c1
Sequence:CCGGGCAGGTAGTAGAACGGAAGATCTCGAGATCTTCCGTTCTACTACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021877.2-4283s21c1
Sequence:CCGGAGTGTCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-2136s21c1
Sequence:CCGGCATCCTGCCAGCATCACTTAGCTCGAGCTAAGTGATGCTGGCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-4222s21c1
Sequence:CCGGGGCGTTACAGGAAGCTAAATACTCGAGTATTTAGCTTCCTGTAACGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-3039s21c1
Sequence:CCGGTGCCCAGTGATGACCGCATTACTCGAGTAATGCGGTCATCACTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-1548s21c1
Sequence:CCGGTTCACAGTCTTGGCAACATTTCTCGAGAAATGTTGCCAAGACTGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021877
HR MISSION shRNA shRNA Plasmid DNA
hair growth associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021877.2-4346s1c1
Sequence:CCGGCCGTTCTACAAATATCTCTTTCTCGAGAAAGAGATATTTGTAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-4162s1c1
Sequence:CCGGCCGTATGCTTTATGCCCAGATCTCGAGATCTGGGCATAAAGCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2314s1c1
Sequence:CCGGCCCAGAAGCTTCACTCAACAACTCGAGTTGTTGAGTGAAGCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2963s1c1
Sequence:CCGGCTAGCCTCTACTGCTGTCAAACTCGAGTTTGACAGCAGTAGAGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-3085s1c1
Sequence:CCGGGCAGGTAGTAGAACGGAAGATCTCGAGATCTTCCGTTCTACTACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021877.2-4283s21c1
Sequence:CCGGAGTGTCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-2136s21c1
Sequence:CCGGCATCCTGCCAGCATCACTTAGCTCGAGCTAAGTGATGCTGGCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-4222s21c1
Sequence:CCGGGGCGTTACAGGAAGCTAAATACTCGAGTATTTAGCTTCCTGTAACGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-3039s21c1
Sequence:CCGGTGCCCAGTGATGACCGCATTACTCGAGTAATGCGGTCATCACTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-1548s21c1
Sequence:CCGGTTCACAGTCTTGGCAACATTTCTCGAGAAATGTTGCCAAGACTGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021877
HR MISSION shRNA Lentiviral Transduction Particles
hair growth associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021877.2-4346s1c1
Sequence:CCGGCCGTTCTACAAATATCTCTTTCTCGAGAAAGAGATATTTGTAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-4162s1c1
Sequence:CCGGCCGTATGCTTTATGCCCAGATCTCGAGATCTGGGCATAAAGCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2314s1c1
Sequence:CCGGCCCAGAAGCTTCACTCAACAACTCGAGTTGTTGAGTGAAGCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-2963s1c1
Sequence:CCGGCTAGCCTCTACTGCTGTCAAACTCGAGTTTGACAGCAGTAGAGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021877.2-3085s1c1
Sequence:CCGGGCAGGTAGTAGAACGGAAGATCTCGAGATCTTCCGTTCTACTACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021877.2-4283s21c1
Sequence:CCGGAGTGTCCAGTCTGCATAATATCTCGAGATATTATGCAGACTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-2136s21c1
Sequence:CCGGCATCCTGCCAGCATCACTTAGCTCGAGCTAAGTGATGCTGGCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-4222s21c1
Sequence:CCGGGGCGTTACAGGAAGCTAAATACTCGAGTATTTAGCTTCCTGTAACGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-3039s21c1
Sequence:CCGGTGCCCAGTGATGACCGCATTACTCGAGTAATGCGGTCATCACTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021877.2-1548s21c1
Sequence:CCGGTTCACAGTCTTGGCAACATTTCTCGAGAAATGTTGCCAAGACTGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005144
VALIDATED
HR MISSION shRNA Bacterial Glycerol Stock
hair growth associated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3897s1c1
Sequence:CCGGGAACGGAAGATCCAGGAGAAACTCGAGTTTCTCCTGGATCTTCCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-4566s1c1
Sequence:CCGGCGGGCACAGAAAGACTTCCTTCTCGAGAAGGAAGTCTTTCTGTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3599s1c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-2336s1c1
Sequence:CCGGCCTTGTTCATACTCTTGGCAACTCGAGTTGCCAAGAGTATGAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-1686s1c1
Sequence:CCGGCCCAAGGACATGCTCCCACTTCTCGAGAAGTGGGAGCATGTCCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2248s21c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-3047s21c1
Sequence:CCGGCAACATCCTGGACAGCATTATCTCGAGATAATGCTGTCCAGGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-1113s21c1
Sequence:CCGGCATCCTACCCACCCACTAAAGCTCGAGCTTTAGTGGGTGGGTAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005144.3-4034s21c1
Sequence:CCGGGGGAATCATTCTGGCTTAAACCTCGAGGTTTAAGCCAGAATGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2438s21c1
Sequence:CCGGTGCTTGGGCCATGAGCGAATACTCGAGTATTCGCTCATGGCCCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-1340s21c1
Sequence:CCGGACCTGGGTTGTTTGGCTTAAACTCGAGTTTAAGCCAAACAACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005144
VALIDATED
HR MISSION shRNA shRNA Plasmid DNA
hair growth associated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3897s1c1
Sequence:CCGGGAACGGAAGATCCAGGAGAAACTCGAGTTTCTCCTGGATCTTCCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-4566s1c1
Sequence:CCGGCGGGCACAGAAAGACTTCCTTCTCGAGAAGGAAGTCTTTCTGTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3599s1c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-2336s1c1
Sequence:CCGGCCTTGTTCATACTCTTGGCAACTCGAGTTGCCAAGAGTATGAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-1686s1c1
Sequence:CCGGCCCAAGGACATGCTCCCACTTCTCGAGAAGTGGGAGCATGTCCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2248s21c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-3047s21c1
Sequence:CCGGCAACATCCTGGACAGCATTATCTCGAGATAATGCTGTCCAGGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-1113s21c1
Sequence:CCGGCATCCTACCCACCCACTAAAGCTCGAGCTTTAGTGGGTGGGTAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005144.3-4034s21c1
Sequence:CCGGGGGAATCATTCTGGCTTAAACCTCGAGGTTTAAGCCAGAATGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2438s21c1
Sequence:CCGGTGCTTGGGCCATGAGCGAATACTCGAGTATTCGCTCATGGCCCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-1340s21c1
Sequence:CCGGACCTGGGTTGTTTGGCTTAAACTCGAGTTTAAGCCAAACAACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005144
VALIDATED
HR MISSION shRNA Lentiviral Transduction Particles
hair growth associated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3897s1c1
Sequence:CCGGGAACGGAAGATCCAGGAGAAACTCGAGTTTCTCCTGGATCTTCCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-4566s1c1
Sequence:CCGGCGGGCACAGAAAGACTTCCTTCTCGAGAAGGAAGTCTTTCTGTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005144.2-3599s1c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-2336s1c1
Sequence:CCGGCCTTGTTCATACTCTTGGCAACTCGAGTTGCCAAGAGTATGAACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005144.2-1686s1c1
Sequence:CCGGCCCAAGGACATGCTCCCACTTCTCGAGAAGTGGGAGCATGTCCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2248s21c1
Sequence:CCGGGCAGAAGGAATCAACACAGAACTCGAGTTCTGTGTTGATTCCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-3047s21c1
Sequence:CCGGCAACATCCTGGACAGCATTATCTCGAGATAATGCTGTCCAGGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-1113s21c1
Sequence:CCGGCATCCTACCCACCCACTAAAGCTCGAGCTTTAGTGGGTGGGTAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005144.3-4034s21c1
Sequence:CCGGGGGAATCATTCTGGCTTAAACCTCGAGGTTTAAGCCAGAATGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.3-2438s21c1
Sequence:CCGGTGCTTGGGCCATGAGCGAATACTCGAGTATTCGCTCATGGCCCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005144.4-1340s21c1
Sequence:CCGGACCTGGGTTGTTTGGCTTAAACTCGAGTTTAAGCCAAACAACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)