EMAIL THIS PAGE TO A FRIEND

HRAS

Harvey rat sarcoma viral oncogene homolog

79 Gene Product Result for
Synonyms: C-BAS/HAS C-H-RAS C-HA-RAS1 CTLO H-RASIDX HAMSV HRAS1 K-RAS N-RAS RASH1
UniProtKB ID: P01112, B5BUA0, Q14080, Q6FHV9, Q9BR65, Q9UCE2
Gene ID:
Human(3265) Summary: This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, mental retardation, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]
Rat(293621) Harvey rat sarcoma virus oncogene
chicken(396229) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
dog(403735) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
cow(100298939) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
sheep(101104357) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
domestic guinea pig(100735038) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
naked mole-rat(101716053) v-Ha-ras Harvey rat sarcoma viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176795 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134211 MISSION® esiRNA esiRNA human HRAS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005343 Rosetta Predictions human pricing
NM_176795 Rosetta Predictions human pricing
NM_001098241 Rosetta Predictions rat pricing
NM_001130441 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231174 predicted 334
2 SASI_Hs01_00231175 predicted 329
3 SASI_Hs01_00231177 predicted 333
4 SASI_Hs01_00231171 predicted 414
5 SASI_Hs01_00231178 predicted 411
6 SASI_Hs01_00231179 predicted 410
7 SASI_Hs01_00231172 predicted 373
8 SASI_Hs01_00231173 predicted 410
9 SASI_Hs01_00231176 predicted 408
10 SASI_Hs01_00231180 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152796 predicted 334
2 SASI_Hs01_00152797 predicted 330
3 SASI_Hs01_00152799 predicted 329
4 SASI_Hs01_00152793 predicted 419
5 SASI_Hs01_00152800 predicted 413
6 SASI_Hs01_00152801 predicted 408
7 SASI_Hs01_00152794 predicted 373
8 SASI_Hs01_00152795 predicted 414
9 SASI_Hs01_00152798 predicted 405
10 SASI_Hs01_00152802 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209121 predicted 306
2 SASI_Rn02_00209122 predicted 451
3 SASI_Rn02_00209123 predicted 426
4 SASI_Rn02_00209124 predicted 470
5 SASI_Rn02_00209125 predicted 315
6 SASI_Rn02_00209126 predicted 429
7 SASI_Rn02_00209127 predicted 478
8 SASI_Rn02_00209128 predicted 466
9 SASI_Rn02_00209129 predicted 303
10 SASI_Rn02_00209130 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255339 predicted 305
2 SASI_Rn02_00255340 predicted 454
3 SASI_Rn02_00255341 predicted 428
4 SASI_Rn02_00255342 predicted 471
5 SASI_Rn02_00255343 predicted 311
6 SASI_Rn02_00255344 predicted 430
7 SASI_Rn02_00255345 predicted 475
8 SASI_Rn02_00255346 predicted 469
9 SASI_Rn02_00255347 predicted 307
10 SASI_Rn02_00255348 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005343
VALIDATED
HRAS MISSION shRNA Bacterial Glycerol Stock
Harvey rat sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-233s21c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-340s21c1
Sequence:CCGGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-296s21c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-45s1c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-108s1c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-309s21c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.x-152s1c1
Sequence:CCGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.1-108s1c1
Sequence:CCGGGAGGATTCCTACCGGAAGCACCTCGAGGTGCTTCCGGTAGGAATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040089    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-45s1c1
Sequence:CCGGAAGAGTGCGCTGACCATCCACCTCGAGGTGGATGGTCAGCGCACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-147s1c1
Sequence:CCGGGACGTGCCTGTTGGACATCCTCTCGAGAGGATGTCCAACAGGCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-359s1c1
Sequence:CCGGTGGCTGCACGCACTGTGGAATCTCGAGATTCCACAGTGCGTGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.1-180s1c1
Sequence:CCGGCCAGGAGGAGTACAGCGCCATCTCGAGATGGCGCTGTACTCCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005343
VALIDATED
HRAS MISSION shRNA shRNA Plasmid DNA
Harvey rat sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-233s21c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-340s21c1
Sequence:CCGGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-296s21c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-45s1c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-108s1c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-309s21c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.x-152s1c1
Sequence:CCGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.1-108s1c1
Sequence:CCGGGAGGATTCCTACCGGAAGCACCTCGAGGTGCTTCCGGTAGGAATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040089    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-45s1c1
Sequence:CCGGAAGAGTGCGCTGACCATCCACCTCGAGGTGGATGGTCAGCGCACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-147s1c1
Sequence:CCGGGACGTGCCTGTTGGACATCCTCTCGAGAGGATGTCCAACAGGCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-359s1c1
Sequence:CCGGTGGCTGCACGCACTGTGGAATCTCGAGATTCCACAGTGCGTGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.1-180s1c1
Sequence:CCGGCCAGGAGGAGTACAGCGCCATCTCGAGATGGCGCTGTACTCCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005343
VALIDATED
HRAS MISSION shRNA Lentiviral Transduction Particles
Harvey rat sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-233s21c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-340s21c1
Sequence:CCGGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-296s21c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-45s1c1
Sequence:CCGGCAAGAGTGCGCTGACCATCCACTCGAGTGGATGGTCAGCGCACTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.x-108s1c1
Sequence:CCGGAGAGGATTCCTACCGGAAGCACTCGAGTGCTTCCGGTAGGAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005343.2-309s21c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.x-152s1c1
Sequence:CCGGCCTGTTGGACATCCTGGATACTCGAGTATCCAGGATGTCCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005343.1-108s1c1
Sequence:CCGGGAGGATTCCTACCGGAAGCACCTCGAGGTGCTTCCGGTAGGAATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040089    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-45s1c1
Sequence:CCGGAAGAGTGCGCTGACCATCCACCTCGAGGTGGATGGTCAGCGCACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-147s1c1
Sequence:CCGGGACGTGCCTGTTGGACATCCTCTCGAGAGGATGTCCAACAGGCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005343.1-359s1c1
Sequence:CCGGTGGCTGCACGCACTGTGGAATCTCGAGATTCCACAGTGCGTGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005343.1-180s1c1
Sequence:CCGGCCAGGAGGAGTACAGCGCCATCTCGAGATGGCGCTGTACTCCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176795
VALIDATED
HRAS MISSION shRNA Bacterial Glycerol Stock
Harvey rat sarcoma viral oncogene homolog
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000033264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-455s1c1
Sequence:CCGGCCACCAGTACAGGGAGCAGATCTCGAGATCTGCTCCCTGTACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-297s1c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176795
VALIDATED
HRAS MISSION shRNA shRNA Plasmid DNA
Harvey rat sarcoma viral oncogene homolog
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000033264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-455s1c1
Sequence:CCGGCCACCAGTACAGGGAGCAGATCTCGAGATCTGCTCCCTGTACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-297s1c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176795
VALIDATED
HRAS MISSION shRNA Lentiviral Transduction Particles
Harvey rat sarcoma viral oncogene homolog
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000033264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-455s1c1
Sequence:CCGGCCACCAGTACAGGGAGCAGATCTCGAGATCTGCTCCCTGTACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A-431
TRC Version: 1 Clone ID:NM_176795.1-297s1c1
Sequence:CCGGCGGAAGCAGGTGGTCATTGATCTCGAGATCAATGACCACCTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)