EMAIL THIS PAGE TO A FRIEND

HRASLS2

HRAS-like suppressor 2

18 Gene Product Result for
Synonyms: PLA1/2-2
UniProtKB ID: Q9NWW9, B9A7L8
Gene ID:
domestic guinea pig(100731098) HRAS-like suppressor 2
cow(100296625) HRAS-like suppressor 2
domestic cat(101090466) HRAS-like suppressor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017878 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049991 MISSION® esiRNA esiRNA human HRASLS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011518 predicted 418
2 SASI_Hs01_00011519 predicted 369
3 SASI_Hs01_00011520 predicted 264
4 SASI_Hs01_00011521 predicted 279
5 SASI_Hs01_00011522 predicted 215
6 SASI_Hs01_00011523 predicted 272
7 SASI_Hs01_00011524 predicted 440
8 SASI_Hs02_00350817 predicted 367
9 SASI_Hs01_00011526 predicted 280
10 SASI_Hs01_00011527 predicted 397
11 SASI_Hs01_00011525 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017878
HRASLS2 MISSION shRNA Bacterial Glycerol Stock
HRAS-like suppressor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-96s1c1
Sequence:CCGGCTGATTGAGATTTCTCGCTTTCTCGAGAAAGCGAGAAATCTCAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-271s1c1
Sequence:CCGGGAGACAACTACAGGGTCAATACTCGAGTATTGACCCTGTAGTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-174s1c1
Sequence:CCGGGCAAGTGAAATTGCTGGAGCTCTCGAGAGCTCCAGCAATTTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-218s1c1
Sequence:CCGGCCTGACCAACAAAGCCATAGTCTCGAGACTATGGCTTTGTTGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-239s1c1
Sequence:CCGGGAAGAAGGAACTGCTGTCTGTCTCGAGACAGACAGCAGTTCCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-87s1c1
Sequence:CCGGCTTGGAGACCTGATTGAGATTCTCGAGAATCTCAATCAGGTCTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-102s1c1
Sequence:CCGGGAGATTTCTCGCTTTGGCTATCTCGAGATAGCCAAAGCGAGAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-577s21c1
Sequence:CCGGATTCTTACGGAGGAATATTATCTCGAGATAATATTCCTCCGTAAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-610s21c1
Sequence:CCGGAGTGGAGTTTGGTTTACTGATCTCGAGATCAGTAAACCAAACTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017878
HRASLS2 MISSION shRNA shRNA Plasmid DNA
HRAS-like suppressor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-96s1c1
Sequence:CCGGCTGATTGAGATTTCTCGCTTTCTCGAGAAAGCGAGAAATCTCAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-271s1c1
Sequence:CCGGGAGACAACTACAGGGTCAATACTCGAGTATTGACCCTGTAGTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-174s1c1
Sequence:CCGGGCAAGTGAAATTGCTGGAGCTCTCGAGAGCTCCAGCAATTTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-218s1c1
Sequence:CCGGCCTGACCAACAAAGCCATAGTCTCGAGACTATGGCTTTGTTGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-239s1c1
Sequence:CCGGGAAGAAGGAACTGCTGTCTGTCTCGAGACAGACAGCAGTTCCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-87s1c1
Sequence:CCGGCTTGGAGACCTGATTGAGATTCTCGAGAATCTCAATCAGGTCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-102s1c1
Sequence:CCGGGAGATTTCTCGCTTTGGCTATCTCGAGATAGCCAAAGCGAGAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-577s21c1
Sequence:CCGGATTCTTACGGAGGAATATTATCTCGAGATAATATTCCTCCGTAAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-610s21c1
Sequence:CCGGAGTGGAGTTTGGTTTACTGATCTCGAGATCAGTAAACCAAACTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017878
HRASLS2 MISSION shRNA Lentiviral Transduction Particles
HRAS-like suppressor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-96s1c1
Sequence:CCGGCTGATTGAGATTTCTCGCTTTCTCGAGAAAGCGAGAAATCTCAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-271s1c1
Sequence:CCGGGAGACAACTACAGGGTCAATACTCGAGTATTGACCCTGTAGTTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-174s1c1
Sequence:CCGGGCAAGTGAAATTGCTGGAGCTCTCGAGAGCTCCAGCAATTTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-218s1c1
Sequence:CCGGCCTGACCAACAAAGCCATAGTCTCGAGACTATGGCTTTGTTGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-239s1c1
Sequence:CCGGGAAGAAGGAACTGCTGTCTGTCTCGAGACAGACAGCAGTTCCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017878.1-87s1c1
Sequence:CCGGCTTGGAGACCTGATTGAGATTCTCGAGAATCTCAATCAGGTCTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017878.1-102s1c1
Sequence:CCGGGAGATTTCTCGCTTTGGCTATCTCGAGATAGCCAAAGCGAGAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-577s21c1
Sequence:CCGGATTCTTACGGAGGAATATTATCTCGAGATAATATTCCTCCGTAAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017878.1-610s21c1
Sequence:CCGGAGTGGAGTTTGGTTTACTGATCTCGAGATCAGTAAACCAAACTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)