EMAIL THIS PAGE TO A FRIEND

HRASLS5

HRAS-like suppressor family, member 5

56 Gene Product Result for
Synonyms: HRLP5 HRSL5 RLP1 iNAT
UniProtKB ID: Q96KN8, B7X6T1, F5GZ87, F5H4Y9
Gene ID:
Mouse(66727) HRAS-like suppressor family, member 5
Rat(293711) HRAS-like suppressor family, member 5
domestic cat(101089718) HRAS-like suppressor family, member 5
cow(522630) HRAS-like suppressor family, member 5
dog(476046) HRAS-like suppressor family, member 5
domestic guinea pig(100730905) HRAS-like suppressor family, member 5
naked mole-rat(101707130) HRAS-like suppressor family, member 5
sheep(101113808) HRAS-like suppressor family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137051 MISSION® esiRNA esiRNA human HRASLS5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054108 Rosetta Predictions human pricing
NM_001039007 Rosetta Predictions rat pricing
NM_025731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052898 predicted 644
2 SASI_Hs01_00052899 predicted 861
3 SASI_Hs01_00052900 predicted 292
4 SASI_Hs02_00361988 predicted 930
5 SASI_Hs01_00052902 predicted 478
6 SASI_Hs01_00052903 predicted 678
7 SASI_Hs01_00052905 predicted 741
8 SASI_Hs01_00052906 predicted 432
9 SASI_Hs01_00052907 predicted 439
10 SASI_Hs02_00361989 predicted 389
11 SASI_Hs01_00052901 predicted 664
12 SASI_Hs01_00052904 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036813 predicted 664
2 SASI_Rn01_00036814 predicted 638
3 SASI_Rn01_00036815 predicted 984
4 SASI_Rn01_00036816 predicted 622
5 SASI_Rn01_00036817 predicted 720
6 SASI_Rn02_00204730 predicted 751
7 SASI_Rn01_00036818 predicted 833
8 SASI_Rn01_00036819 predicted 686
9 SASI_Rn01_00036820 predicted 1194
10 SASI_Rn02_00204731 predicted 734
11 SASI_Rn01_00036821 predicted 734
12 SASI_Rn01_00036822 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328914 predicted 784
2 SASI_Mm01_00155816 predicted 247
3 SASI_Mm01_00155817 predicted 406
4 SASI_Mm01_00155818 predicted 672
5 SASI_Mm01_00155820 predicted 248
6 SASI_Mm01_00155821 predicted 362
7 SASI_Mm01_00155822 predicted 269
8 SASI_Mm01_00155823 predicted 363
9 SASI_Mm01_00155824 predicted 206
10 SASI_Mm01_00155825 predicted 312
11 SASI_Mm01_00155819 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054108
HRASLS5 MISSION shRNA Bacterial Glycerol Stock
HRAS-like suppressor family, member 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-513s21c1
Sequence:CCGGTGAGAATGAAGGCAAGTTAATCTCGAGATTAACTTGCCTTCATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-602s21c1
Sequence:CCGGATGAGCACTGGGCCATCTATGCTCGAGCATAGATGGCCCAGTGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-695s1c1
Sequence:CCGGCGTGGTGAAATACAGTCGTCTCTCGAGAGACGACTGTATTTCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-664s1c1
Sequence:CCGGGCAGCATTACTTCCATCTTTACTCGAGTAAAGATGGAAGTAATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-329s1c1
Sequence:CCGGCCTTGAATTAGAAGAATCCGTCTCGAGACGGATTCTTCTAATTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054108.1-1023s1c1
Sequence:CCGGGAGGAAGAGTTACTGACACAACTCGAGTTGTGTCAGTAACTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-815s1c1
Sequence:CCGGGATGGTCAACAAGATCGTGCACTCGAGTGCACGATCTTGTTGACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-612s1c1
Sequence:CCGGGAAGATGATTGCGTGGTCCATCTCGAGATGGACCACGCAATCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-831s1c1
Sequence:CCGGGTGCAGTACAGCCTGATTGAACTCGAGTTCAATCAGGCTGTACTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054108.3-1260s21c1
Sequence:CCGGCATTTCATATACGGATCTAATCTCGAGATTAGATCCGTATATGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-973s1c1
Sequence:CCGGGCATAAAGCCCAAACCAATAACTCGAGTTATTGGTTTGGGCTTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054108
HRASLS5 MISSION shRNA shRNA Plasmid DNA
HRAS-like suppressor family, member 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-513s21c1
Sequence:CCGGTGAGAATGAAGGCAAGTTAATCTCGAGATTAACTTGCCTTCATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-602s21c1
Sequence:CCGGATGAGCACTGGGCCATCTATGCTCGAGCATAGATGGCCCAGTGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-695s1c1
Sequence:CCGGCGTGGTGAAATACAGTCGTCTCTCGAGAGACGACTGTATTTCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-664s1c1
Sequence:CCGGGCAGCATTACTTCCATCTTTACTCGAGTAAAGATGGAAGTAATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-329s1c1
Sequence:CCGGCCTTGAATTAGAAGAATCCGTCTCGAGACGGATTCTTCTAATTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054108.1-1023s1c1
Sequence:CCGGGAGGAAGAGTTACTGACACAACTCGAGTTGTGTCAGTAACTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-815s1c1
Sequence:CCGGGATGGTCAACAAGATCGTGCACTCGAGTGCACGATCTTGTTGACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-612s1c1
Sequence:CCGGGAAGATGATTGCGTGGTCCATCTCGAGATGGACCACGCAATCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-831s1c1
Sequence:CCGGGTGCAGTACAGCCTGATTGAACTCGAGTTCAATCAGGCTGTACTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054108.3-1260s21c1
Sequence:CCGGCATTTCATATACGGATCTAATCTCGAGATTAGATCCGTATATGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-973s1c1
Sequence:CCGGGCATAAAGCCCAAACCAATAACTCGAGTTATTGGTTTGGGCTTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054108
HRASLS5 MISSION shRNA Lentiviral Transduction Particles
HRAS-like suppressor family, member 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-513s21c1
Sequence:CCGGTGAGAATGAAGGCAAGTTAATCTCGAGATTAACTTGCCTTCATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054108.3-602s21c1
Sequence:CCGGATGAGCACTGGGCCATCTATGCTCGAGCATAGATGGCCCAGTGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-695s1c1
Sequence:CCGGCGTGGTGAAATACAGTCGTCTCTCGAGAGACGACTGTATTTCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-664s1c1
Sequence:CCGGGCAGCATTACTTCCATCTTTACTCGAGTAAAGATGGAAGTAATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-329s1c1
Sequence:CCGGCCTTGAATTAGAAGAATCCGTCTCGAGACGGATTCTTCTAATTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054108.1-1023s1c1
Sequence:CCGGGAGGAAGAGTTACTGACACAACTCGAGTTGTGTCAGTAACTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-815s1c1
Sequence:CCGGGATGGTCAACAAGATCGTGCACTCGAGTGCACGATCTTGTTGACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-612s1c1
Sequence:CCGGGAAGATGATTGCGTGGTCCATCTCGAGATGGACCACGCAATCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-831s1c1
Sequence:CCGGGTGCAGTACAGCCTGATTGAACTCGAGTTCAATCAGGCTGTACTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054108.3-1260s21c1
Sequence:CCGGCATTTCATATACGGATCTAATCTCGAGATTAGATCCGTATATGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054108.1-973s1c1
Sequence:CCGGGCATAAAGCCCAAACCAATAACTCGAGTTATTGGTTTGGGCTTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025731
HRASLS5 MISSION shRNA Bacterial Glycerol Stock
HRAS-like suppressor family, member 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-794s21c1
Sequence:CCGGTTGTCAATGACCTCAGATATGCTCGAGCATATCTGAGGTCATTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-755s21c1
Sequence:CCGGTAGTTCAGTACAGCCTAATTGCTCGAGCAATTAGGCTGTACTGAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-310s21c1
Sequence:CCGGCTCAAGCAAGACCGCCGATTACTCGAGTAATCGGCGGTCTTGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-518s21c1
Sequence:CCGGATGAACATTGGGCCATCTATGCTCGAGCATAGATGGCCCAATGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025731.1-887s1c1
Sequence:CCGGGCAGTAGTAGATAGCATAAGACTCGAGTCTTATGCTATCTACTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-407s21c1
Sequence:CCGGAGCTGATTCCAACATCAAATTCTCGAGAATTTGATGTTGGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025731
HRASLS5 MISSION shRNA shRNA Plasmid DNA
HRAS-like suppressor family, member 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-794s21c1
Sequence:CCGGTTGTCAATGACCTCAGATATGCTCGAGCATATCTGAGGTCATTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-755s21c1
Sequence:CCGGTAGTTCAGTACAGCCTAATTGCTCGAGCAATTAGGCTGTACTGAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-310s21c1
Sequence:CCGGCTCAAGCAAGACCGCCGATTACTCGAGTAATCGGCGGTCTTGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-518s21c1
Sequence:CCGGATGAACATTGGGCCATCTATGCTCGAGCATAGATGGCCCAATGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025731.1-887s1c1
Sequence:CCGGGCAGTAGTAGATAGCATAAGACTCGAGTCTTATGCTATCTACTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-407s21c1
Sequence:CCGGAGCTGATTCCAACATCAAATTCTCGAGAATTTGATGTTGGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025731
HRASLS5 MISSION shRNA Lentiviral Transduction Particles
HRAS-like suppressor family, member 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-794s21c1
Sequence:CCGGTTGTCAATGACCTCAGATATGCTCGAGCATATCTGAGGTCATTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-755s21c1
Sequence:CCGGTAGTTCAGTACAGCCTAATTGCTCGAGCAATTAGGCTGTACTGAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-310s21c1
Sequence:CCGGCTCAAGCAAGACCGCCGATTACTCGAGTAATCGGCGGTCTTGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-518s21c1
Sequence:CCGGATGAACATTGGGCCATCTATGCTCGAGCATAGATGGCCCAATGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025731.1-887s1c1
Sequence:CCGGGCAGTAGTAGATAGCATAAGACTCGAGTCTTATGCTATCTACTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025731.2-407s21c1
Sequence:CCGGAGCTGATTCCAACATCAAATTCTCGAGAATTTGATGTTGGAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)