EMAIL THIS PAGE TO A FRIEND

HRASLS

HRAS-like suppressor

62 Gene Product Result for
Synonyms: A-C1 H-REV107 HRASLS1 HRSL1 HSD28
UniProtKB ID: Q9HDD0, D2KX19
Gene ID:
Mouse(27281) HRAS-like suppressor
Rat(288025) HRAS-like suppressor
chicken(424903) HRAS-like suppressor
cow(540539) HRAS-like suppressor
domestic cat(101091966) HRAS-like suppressor
dog(478677) HRAS-like suppressor
domestic guinea pig(100734007) HRAS-like suppressor
naked mole-rat(101700575) HRAS-like suppressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009181 MISSION® esiRNA esiRNA targeting human HRASLS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020386 Rosetta Predictions human pricing
NM_001105871 Rosetta Predictions rat pricing
NM_013751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168520 predicted 820
2 SASI_Hs02_00353353 predicted 812
3 SASI_Hs01_00168524 predicted 715
4 SASI_Hs02_00353354 predicted 732
5 SASI_Hs02_00353355 predicted 813
6 SASI_Hs01_00168527 predicted 498
7 SASI_Hs01_00168528 predicted 404
8 SASI_Hs01_00168529 predicted 828
9 SASI_Hs02_00353356 predicted 770
10 SASI_Hs02_00353357 predicted 497
11 SASI_Hs01_00168521 predicted 753
12 SASI_Hs01_00168522 predicted 741
13 SASI_Hs01_00168523 predicted 593
14 SASI_Hs01_00168525 predicted 707
15 SASI_Hs01_00168526 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213352 predicted 474
2 SASI_Rn02_00213353 predicted 362
3 SASI_Rn02_00213354 predicted 448
4 SASI_Rn02_00213355 predicted 371
5 SASI_Rn02_00213356 predicted 495
6 SASI_Rn02_00213357 predicted 197
7 SASI_Rn02_00213358 predicted 604
8 SASI_Rn02_00213359 predicted 920
9 SASI_Rn02_00213360 predicted 479
10 SASI_Rn02_00213361 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130244 predicted 262
2 SASI_Mm01_00130245 predicted 328
3 SASI_Mm01_00130246 predicted 978
4 SASI_Mm01_00130247 predicted 251
5 SASI_Mm01_00130248 predicted 223
6 SASI_Mm01_00130249 predicted 344
7 SASI_Mm01_00130250 predicted 415
8 SASI_Mm01_00130251 predicted 245
9 SASI_Mm01_00130252 predicted 371
10 SASI_Mm01_00130253 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020386
HRASLS MISSION shRNA Bacterial Glycerol Stock
HRAS-like suppressor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-783s21c1
Sequence:CCGGTCGCTATGGAGAAGGAGTTTCCTCGAGGAAACTCCTTCTCCATAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-545s21c1
Sequence:CCGGATGGCATTCCTGCGTCCTTTACTCGAGTAAAGGACGCAGGAATGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-507s21c1
Sequence:CCGGCTTGGGTGATGGTTACGTTATCTCGAGATAACGTAACCATCACCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-654s1c1
Sequence:CCGGCTGCTGTTGGTGTCTTCTCATCTCGAGATGAGAAGACACCAACAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-821s21c1
Sequence:CCGGCGATAAGTACCGTTGAGTTTGCTCGAGCAAACTCAACGGTACTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-307s1c1
Sequence:CCGGCCTGTACTTGGGTGATGGTTACTCGAGTAACCATCACCCAAGTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-626s1c1
Sequence:CCGGGCGATAAGTACCGTTGAGTTTCTCGAGAAACTCAACGGTACTTATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020386.x-795s1c1
Sequence:CCGGGTGCATCATTACTGTTCCAGACTCGAGTCTGGAACAGTAATGATGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-723s21c1
Sequence:CCGGTGGACAGGAGGTGGCCTATAACTCGAGTTATAGGCCACCTCCTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020386
HRASLS MISSION shRNA shRNA Plasmid DNA
HRAS-like suppressor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-783s21c1
Sequence:CCGGTCGCTATGGAGAAGGAGTTTCCTCGAGGAAACTCCTTCTCCATAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-545s21c1
Sequence:CCGGATGGCATTCCTGCGTCCTTTACTCGAGTAAAGGACGCAGGAATGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-507s21c1
Sequence:CCGGCTTGGGTGATGGTTACGTTATCTCGAGATAACGTAACCATCACCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-654s1c1
Sequence:CCGGCTGCTGTTGGTGTCTTCTCATCTCGAGATGAGAAGACACCAACAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-821s21c1
Sequence:CCGGCGATAAGTACCGTTGAGTTTGCTCGAGCAAACTCAACGGTACTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-307s1c1
Sequence:CCGGCCTGTACTTGGGTGATGGTTACTCGAGTAACCATCACCCAAGTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-626s1c1
Sequence:CCGGGCGATAAGTACCGTTGAGTTTCTCGAGAAACTCAACGGTACTTATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020386.x-795s1c1
Sequence:CCGGGTGCATCATTACTGTTCCAGACTCGAGTCTGGAACAGTAATGATGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-723s21c1
Sequence:CCGGTGGACAGGAGGTGGCCTATAACTCGAGTTATAGGCCACCTCCTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020386
HRASLS MISSION shRNA Lentiviral Transduction Particles
HRAS-like suppressor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-783s21c1
Sequence:CCGGTCGCTATGGAGAAGGAGTTTCCTCGAGGAAACTCCTTCTCCATAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-545s21c1
Sequence:CCGGATGGCATTCCTGCGTCCTTTACTCGAGTAAAGGACGCAGGAATGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-507s21c1
Sequence:CCGGCTTGGGTGATGGTTACGTTATCTCGAGATAACGTAACCATCACCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-654s1c1
Sequence:CCGGCTGCTGTTGGTGTCTTCTCATCTCGAGATGAGAAGACACCAACAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-821s21c1
Sequence:CCGGCGATAAGTACCGTTGAGTTTGCTCGAGCAAACTCAACGGTACTTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-307s1c1
Sequence:CCGGCCTGTACTTGGGTGATGGTTACTCGAGTAACCATCACCCAAGTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020386.x-626s1c1
Sequence:CCGGGCGATAAGTACCGTTGAGTTTCTCGAGAAACTCAACGGTACTTATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020386.x-795s1c1
Sequence:CCGGGTGCATCATTACTGTTCCAGACTCGAGTCTGGAACAGTAATGATGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020386.3-723s21c1
Sequence:CCGGTGGACAGGAGGTGGCCTATAACTCGAGTTATAGGCCACCTCCTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013751
HRASLS MISSION shRNA Bacterial Glycerol Stock
HRAS-like suppressor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-572s1c1
Sequence:CCGGCTTCACATTCCTCGGCTTGTTCTCGAGAACAAGCCGAGGAATGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-266s1c1
Sequence:CCGGCTCATCATTTACAAGTGCTAACTCGAGTTAGCACTTGTAAATGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-414s1c1
Sequence:CCGGCAACGGTCAGAGTTCGCTATTCTCGAGAATAGCGAACTCTGACCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013751.3-1035s1c1
Sequence:CCGGGCGTGAACATATCCAGTAGTTCTCGAGAACTACTGGATATGTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-233s1c1
Sequence:CCGGCGTGATCAACATTGCACCTATCTCGAGATAGGTGCAATGTTGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013751
HRASLS MISSION shRNA shRNA Plasmid DNA
HRAS-like suppressor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-572s1c1
Sequence:CCGGCTTCACATTCCTCGGCTTGTTCTCGAGAACAAGCCGAGGAATGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-266s1c1
Sequence:CCGGCTCATCATTTACAAGTGCTAACTCGAGTTAGCACTTGTAAATGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-414s1c1
Sequence:CCGGCAACGGTCAGAGTTCGCTATTCTCGAGAATAGCGAACTCTGACCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013751.3-1035s1c1
Sequence:CCGGGCGTGAACATATCCAGTAGTTCTCGAGAACTACTGGATATGTTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-233s1c1
Sequence:CCGGCGTGATCAACATTGCACCTATCTCGAGATAGGTGCAATGTTGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013751
HRASLS MISSION shRNA Lentiviral Transduction Particles
HRAS-like suppressor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-572s1c1
Sequence:CCGGCTTCACATTCCTCGGCTTGTTCTCGAGAACAAGCCGAGGAATGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-266s1c1
Sequence:CCGGCTCATCATTTACAAGTGCTAACTCGAGTTAGCACTTGTAAATGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-414s1c1
Sequence:CCGGCAACGGTCAGAGTTCGCTATTCTCGAGAATAGCGAACTCTGACCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013751.3-1035s1c1
Sequence:CCGGGCGTGAACATATCCAGTAGTTCTCGAGAACTACTGGATATGTTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013751.3-233s1c1
Sequence:CCGGCGTGATCAACATTGCACCTATCTCGAGATAGGTGCAATGTTGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)