EMAIL THIS PAGE TO A FRIEND

HRCT1

histidine rich carboxyl terminus 1

29 Gene Product Result for
Synonyms: LGLL338 PRO537 UNQ338
UniProtKB ID: Q6UXD1, B7ZBJ1
Gene ID:
Mouse(100039781) histidine rich carboxyl terminus 1
Rat(100359865) histidine rich carboxyl terminus 1
naked mole-rat(101711670) histidine rich carboxyl terminus 1
domestic cat(101088526) histidine rich carboxyl terminus 1
cow(100847747) histidine rich carboxyl terminus 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067038 Anti-HRCT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039792 Rosetta Predictions human pricing
NM_027511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219936 predicted 699
2 SASI_Hs01_00219937 predicted 634
3 SASI_Hs01_00219938 predicted 690
4 SASI_Hs01_00219939 predicted 639
5 SASI_Hs01_00219940 predicted 701
6 SASI_Hs01_00219941 predicted 695
7 SASI_Hs01_00219942 predicted 700
8 SASI_Hs01_00219943 predicted 695
9 SASI_Hs01_00219944 predicted 641
10 SASI_Hs01_00219945 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332337 predicted 666
2 SASI_Mm02_00332338 predicted 206
3 SASI_Mm02_00332339 predicted 198
4 SASI_Mm02_00332340 predicted 298
5 SASI_Mm02_00332341 predicted 755
6 SASI_Mm02_00332342 predicted 743
7 SASI_Mm02_00332343 predicted 777
8 SASI_Mm02_00332344 predicted 792
9 SASI_Mm02_00332345 predicted 340
10 SASI_Mm02_00332346 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039792
VALIDATED
HRCT1 MISSION shRNA Bacterial Glycerol Stock
histidine rich carboxyl terminus 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039792.1-293s21c1
Sequence:CCGGACCTGGGAATCTTTCACCATCCTCGAGGATGGTGAAAGATTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-303s21c1
Sequence:CCGGCTTTCACCATCACCGTCATCCCTCGAGGGATGACGGTGATGGTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-319s21c1
Sequence:CCGGCATCCTGGCCACGTATCTCATCTCGAGATGAGATACGTGGCCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-329s21c1
Sequence:CCGGACGTATCTCATGTGCCGAATGCTCGAGCATTCGGCACATGAGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039792.1-777s21c1
Sequence:CCGGTGGATGTGAAGTGCCCGTCTTCTCGAGAAGACGGGCACTTCACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039792
VALIDATED
HRCT1 MISSION shRNA shRNA Plasmid DNA
histidine rich carboxyl terminus 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039792.1-293s21c1
Sequence:CCGGACCTGGGAATCTTTCACCATCCTCGAGGATGGTGAAAGATTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-303s21c1
Sequence:CCGGCTTTCACCATCACCGTCATCCCTCGAGGGATGACGGTGATGGTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-319s21c1
Sequence:CCGGCATCCTGGCCACGTATCTCATCTCGAGATGAGATACGTGGCCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-329s21c1
Sequence:CCGGACGTATCTCATGTGCCGAATGCTCGAGCATTCGGCACATGAGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039792.1-777s21c1
Sequence:CCGGTGGATGTGAAGTGCCCGTCTTCTCGAGAAGACGGGCACTTCACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039792
VALIDATED
HRCT1 MISSION shRNA Lentiviral Transduction Particles
histidine rich carboxyl terminus 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039792.1-293s21c1
Sequence:CCGGACCTGGGAATCTTTCACCATCCTCGAGGATGGTGAAAGATTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-303s21c1
Sequence:CCGGCTTTCACCATCACCGTCATCCCTCGAGGGATGACGGTGATGGTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-319s21c1
Sequence:CCGGCATCCTGGCCACGTATCTCATCTCGAGATGAGATACGTGGCCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001039792.1-329s21c1
Sequence:CCGGACGTATCTCATGTGCCGAATGCTCGAGCATTCGGCACATGAGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039792.1-777s21c1
Sequence:CCGGTGGATGTGAAGTGCCCGTCTTCTCGAGAAGACGGGCACTTCACATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027511
VALIDATED
HRCT1 MISSION shRNA Bacterial Glycerol Stock
histidine rich carboxyl terminus 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-487s21c1
Sequence:CCGGGCCGCTGAGGCCAATAGATAGCTCGAGCTATCTATTGGCCTCAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-348s21c1
Sequence:CCGGCCAAGACTTGTTCACCATCACCTCGAGGTGATGGTGAACAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-288s21c1
Sequence:CCGGGAGAGAAACCGAGTCCGACAACTCGAGTTGTCGGACTCGGTTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027511.1-611s21c1
Sequence:CCGGGGTCCTGCTTGGGTTTCATTTCTCGAGAAATGAAACCCAAGCAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-409s21c1
Sequence:CCGGACCACCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027511
VALIDATED
HRCT1 MISSION shRNA shRNA Plasmid DNA
histidine rich carboxyl terminus 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-487s21c1
Sequence:CCGGGCCGCTGAGGCCAATAGATAGCTCGAGCTATCTATTGGCCTCAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-348s21c1
Sequence:CCGGCCAAGACTTGTTCACCATCACCTCGAGGTGATGGTGAACAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-288s21c1
Sequence:CCGGGAGAGAAACCGAGTCCGACAACTCGAGTTGTCGGACTCGGTTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027511.1-611s21c1
Sequence:CCGGGGTCCTGCTTGGGTTTCATTTCTCGAGAAATGAAACCCAAGCAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-409s21c1
Sequence:CCGGACCACCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027511
VALIDATED
HRCT1 MISSION shRNA Lentiviral Transduction Particles
histidine rich carboxyl terminus 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-487s21c1
Sequence:CCGGGCCGCTGAGGCCAATAGATAGCTCGAGCTATCTATTGGCCTCAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-348s21c1
Sequence:CCGGCCAAGACTTGTTCACCATCACCTCGAGGTGATGGTGAACAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-288s21c1
Sequence:CCGGGAGAGAAACCGAGTCCGACAACTCGAGTTGTCGGACTCGGTTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027511.1-611s21c1
Sequence:CCGGGGTCCTGCTTGGGTTTCATTTCTCGAGAAATGAAACCCAAGCAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027511.1-409s21c1
Sequence:CCGGACCACCACCATCACCATTCTCCTCGAGGAGAATGGTGATGGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)