EMAIL THIS PAGE TO A FRIEND

HRG

histidine-rich glycoprotein

82 Gene Product Result for
Synonyms: HPRG HRGP THPH11
UniProtKB ID: P04196, B9EK35, D3DNU7
Gene ID:
Human(3273) Summary: This histidine-rich glycoprotein contains two cystatin-like domains and is located in plasma and platelets. The physiological function has not been determined but it is known that the protein binds heme, dyes and divalent metal ions. It can inhibit rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. Mutations in this gene lead to thrombophilia due to abnormal histidine-rich glycoprotein levels. [provided by RefSeq, Jul 2008]
Mouse(94175) histidine-rich glycoprotein
Rat(171016) histidine-rich glycoprotein
chicken(770588) histidine-rich glycoprotein
domestic cat(101082002) histidine-rich glycoprotein
cow(280820) histidine-rich glycoprotein
sheep(101113377) histidine-rich glycoprotein
Domestic Rabbit(100009395) histidine-rich glycoprotein
domestic guinea pig(100735310) histidine-rich glycoprotein
naked mole-rat(101722102) histidine-rich glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1505 Human HPRG ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000412 Rosetta Predictions human pricing
NM_133428 Rosetta Predictions rat pricing
XM_579622 Rosetta Predictions rat pricing
NM_053176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095804 predicted 314
2 SASI_Hs01_00095806 predicted 323
3 SASI_Hs01_00095807 predicted 383
4 SASI_Hs02_00302504 predicted 461
5 SASI_Hs01_00095809 predicted 218
6 SASI_Hs01_00095810 predicted 533
7 SASI_Hs01_00095811 predicted 339
8 SASI_Hs01_00095812 predicted 1473
9 SASI_Hs01_00095813 predicted 251
10 SASI_Hs02_00302505 predicted 1517
11 SASI_Hs01_00095805 predicted 215
12 SASI_Hs01_00095808 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067761 predicted 352
2 SASI_Rn01_00067762 predicted 347
3 SASI_Rn01_00067763 predicted 409
4 SASI_Rn02_00267687 predicted 378
5 SASI_Rn01_00067765 predicted 1402
6 SASI_Rn02_00267688 predicted 1433
7 SASI_Rn01_00067766 predicted 449
8 SASI_Rn01_00067768 predicted 831
9 SASI_Rn01_00067769 predicted 520
10 SASI_Rn01_00067770 predicted 461
11 SASI_Rn01_00067764 predicted 394
12 SASI_Rn01_00067767 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189797 predicted 359
2 SASI_Rn01_00189798 predicted 350
3 SASI_Rn01_00189799 predicted 414
4 SASI_Rn01_00189800 predicted 399
5 SASI_Rn01_00189801 predicted 1408
6 SASI_Rn01_00189802 predicted 450
7 SASI_Rn01_00189803 predicted 616
8 SASI_Rn01_00189804 predicted 839
9 SASI_Rn01_00189805 predicted 521
10 SASI_Rn01_00189806 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169108 predicted 349
2 SASI_Mm01_00169109 predicted 604
3 SASI_Mm01_00169110 predicted 330
4 SASI_Mm01_00169112 predicted 235
5 SASI_Mm01_00169113 predicted 382
6 SASI_Mm01_00169114 predicted 306
7 SASI_Mm01_00169115 predicted 237
8 SASI_Mm01_00169116 predicted 411
9 SASI_Mm01_00169117 predicted 368
10 SASI_Mm02_00337734 predicted 337
11 SASI_Mm01_00169111 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000412
HRG MISSION shRNA Bacterial Glycerol Stock
histidine-rich glycoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-327s21c1
Sequence:CCGGATCGGACAATGTAAGGTAATACTCGAGTATTACCTTACATTGTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-122s21c1
Sequence:CCGGAGCTCTAGACCTGATCAATAACTCGAGTTATTGATCAGGTCTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000412.2-1790s1c1
Sequence:CCGGGCTGCCTATTAGTAGTTAATTCTCGAGAATTAACTACTAATAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1285s1c1
Sequence:CCGGCCCATAACCAAGGTCACTGTTCTCGAGAACAGTGACCTTGGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-400s1c1
Sequence:CCGGGCACCACAAGTTCTGTCTCTTCTCGAGAAGAGACAGAACTTGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1135s1c1
Sequence:CCGGCTCATGAACATGATACCCATACTCGAGTATGGGTATCATGTTCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1032s1c1
Sequence:CCGGGCCCAAAGACATTCTCATAATCTCGAGATTATGAGAATGTCTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-779s21c1
Sequence:CCGGCAATGGTGTACCGCCTCATTTCTCGAGAAATGAGGCGGTACACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000412
HRG MISSION shRNA shRNA Plasmid DNA
histidine-rich glycoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-327s21c1
Sequence:CCGGATCGGACAATGTAAGGTAATACTCGAGTATTACCTTACATTGTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-122s21c1
Sequence:CCGGAGCTCTAGACCTGATCAATAACTCGAGTTATTGATCAGGTCTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000412.2-1790s1c1
Sequence:CCGGGCTGCCTATTAGTAGTTAATTCTCGAGAATTAACTACTAATAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1285s1c1
Sequence:CCGGCCCATAACCAAGGTCACTGTTCTCGAGAACAGTGACCTTGGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-400s1c1
Sequence:CCGGGCACCACAAGTTCTGTCTCTTCTCGAGAAGAGACAGAACTTGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1135s1c1
Sequence:CCGGCTCATGAACATGATACCCATACTCGAGTATGGGTATCATGTTCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1032s1c1
Sequence:CCGGGCCCAAAGACATTCTCATAATCTCGAGATTATGAGAATGTCTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-779s21c1
Sequence:CCGGCAATGGTGTACCGCCTCATTTCTCGAGAAATGAGGCGGTACACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000412
HRG MISSION shRNA Lentiviral Transduction Particles
histidine-rich glycoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-327s21c1
Sequence:CCGGATCGGACAATGTAAGGTAATACTCGAGTATTACCTTACATTGTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-122s21c1
Sequence:CCGGAGCTCTAGACCTGATCAATAACTCGAGTTATTGATCAGGTCTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000412.2-1790s1c1
Sequence:CCGGGCTGCCTATTAGTAGTTAATTCTCGAGAATTAACTACTAATAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1285s1c1
Sequence:CCGGCCCATAACCAAGGTCACTGTTCTCGAGAACAGTGACCTTGGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-400s1c1
Sequence:CCGGGCACCACAAGTTCTGTCTCTTCTCGAGAAGAGACAGAACTTGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1135s1c1
Sequence:CCGGCTCATGAACATGATACCCATACTCGAGTATGGGTATCATGTTCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000412.2-1032s1c1
Sequence:CCGGGCCCAAAGACATTCTCATAATCTCGAGATTATGAGAATGTCTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000412.2-779s21c1
Sequence:CCGGCAATGGTGTACCGCCTCATTTCTCGAGAAATGAGGCGGTACACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053176
HRG MISSION shRNA Bacterial Glycerol Stock
histidine-rich glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1429s1c1
Sequence:CCGGCCACTGAATATAGGTGAAGTTCTCGAGAACTTCACCTATATTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1426s1c1
Sequence:CCGGCCTCCACTGAATATAGGTGAACTCGAGTTCACCTATATTCAGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-339s1c1
Sequence:CCGGGATTGGACAATGTAAGGTAATCTCGAGATTACCTTACATTGTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-235s1c1
Sequence:CCGGACAGTCTACTACTTAGCTTTACTCGAGTAAAGCTAAGTAGTAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-823s1c1
Sequence:CCGGCGTCCTCTTTGTGACAAACATCTCGAGATGTTTGTCACAAAGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053176
HRG MISSION shRNA shRNA Plasmid DNA
histidine-rich glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1429s1c1
Sequence:CCGGCCACTGAATATAGGTGAAGTTCTCGAGAACTTCACCTATATTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1426s1c1
Sequence:CCGGCCTCCACTGAATATAGGTGAACTCGAGTTCACCTATATTCAGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-339s1c1
Sequence:CCGGGATTGGACAATGTAAGGTAATCTCGAGATTACCTTACATTGTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-235s1c1
Sequence:CCGGACAGTCTACTACTTAGCTTTACTCGAGTAAAGCTAAGTAGTAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-823s1c1
Sequence:CCGGCGTCCTCTTTGTGACAAACATCTCGAGATGTTTGTCACAAAGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053176
HRG MISSION shRNA Lentiviral Transduction Particles
histidine-rich glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1429s1c1
Sequence:CCGGCCACTGAATATAGGTGAAGTTCTCGAGAACTTCACCTATATTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-1426s1c1
Sequence:CCGGCCTCCACTGAATATAGGTGAACTCGAGTTCACCTATATTCAGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-339s1c1
Sequence:CCGGGATTGGACAATGTAAGGTAATCTCGAGATTACCTTACATTGTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-235s1c1
Sequence:CCGGACAGTCTACTACTTAGCTTTACTCGAGTAAAGCTAAGTAGTAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053176.1-823s1c1
Sequence:CCGGCGTCCTCTTTGTGACAAACATCTCGAGATGTTTGTCACAAAGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)