EMAIL THIS PAGE TO A FRIEND

HRH1

histamine receptor H1

121 Gene Product Result for
Synonyms: H1-R hisH1
UniProtKB ID: P35367, A8K047, Q6P9E5
Gene ID:
Human(3269) Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene was thought to be intronless until recently. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(15465) histamine receptor H1
Rat(24448) histamine receptor H 1
Zebrafish(735302) histamine receptor H1
dog(403813) histamine receptor H1
domestic cat(101088314) histamine receptor H1
cow(281231) histamine receptor H1
Horse(100034110) histamine receptor H1
chicken(100858928) histamine receptor H1
domestic guinea pig(100135539) histamine receptor H1
domestic guinea pig(100730517) histamine receptor H1
naked mole-rat(101715481) histamine receptor H1
sheep(101121717) histamine receptor H1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
H7250 Histamine dihydrochloride ≥99% (TLC), powder human pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H7625 D-Histidine monohydrochloride monohydrate ≥98% (TLC) human, mouse, rat pricing
H6647 L-Histidinol dihydrochloride ≥98 (TLC) human, mouse, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C5270 Cinnarizine powder human pricing
L9664 Loratadine ≥98% (HPLC), powder human, rat pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
M4910 1-Methylhistamine dihydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
A55306 2-(2-Pyridyl)ethylamine 95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000861 Rosetta Predictions human pricing
NM_001098211 Rosetta Predictions human pricing
NM_001098212 Rosetta Predictions human pricing
NM_001098213 Rosetta Predictions human pricing
NM_017018 Rosetta Predictions rat pricing
NM_008285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204537 predicted 808
2 SASI_Hs01_00204538 predicted 1235
3 SASI_Hs01_00204539 predicted 1631
4 SASI_Hs01_00204540 predicted 1326
5 SASI_Hs01_00204541 predicted 1099
6 SASI_Hs01_00204542 predicted 1378
7 SASI_Hs02_00303379 predicted 1093
8 SASI_Hs01_00204543 predicted 1504
9 SASI_Hs02_00303380 predicted 1621
10 SASI_Hs01_00204544 predicted 1374
11 SASI_Hs01_00204545 predicted 1302
12 SASI_Hs01_00204546 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318718 predicted 733
2 SASI_Hs02_00318719 predicted 1160
3 SASI_Hs02_00318720 predicted 1561
4 SASI_Hs02_00318721 predicted 1241
5 SASI_Hs02_00318722 predicted 1018
6 SASI_Hs02_00318723 predicted 1307
7 SASI_Hs02_00318724 predicted 1011
8 SASI_Hs02_00318725 predicted 1431
9 SASI_Hs02_00318726 predicted 1537
10 SASI_Hs02_00318727 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318728 predicted 683
2 SASI_Hs02_00318729 predicted 1102
3 SASI_Hs02_00318730 predicted 1509
4 SASI_Hs02_00318731 predicted 1192
5 SASI_Hs02_00318732 predicted 970
6 SASI_Hs02_00318733 predicted 1254
7 SASI_Hs02_00318734 predicted 963
8 SASI_Hs02_00318735 predicted 1375
9 SASI_Hs02_00318736 predicted 1489
10 SASI_Hs02_00318737 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318738 predicted 958
2 SASI_Hs02_00318739 predicted 1384
3 SASI_Hs02_00318740 predicted 1783
4 SASI_Hs02_00318741 predicted 1471
5 SASI_Hs02_00318742 predicted 1243
6 SASI_Hs02_00318743 predicted 1535
7 SASI_Hs02_00318744 predicted 1243
8 SASI_Hs02_00318745 predicted 1662
9 SASI_Hs02_00318746 predicted 1774
10 SASI_Hs02_00318747 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081325 predicted 722
2 SASI_Rn01_00081326 predicted 1131
3 SASI_Rn01_00081327 predicted 1001
4 SASI_Rn01_00081328 predicted 715
5 SASI_Rn01_00081329 predicted 888
6 SASI_Rn01_00081330 predicted 886
7 SASI_Rn01_00081331 predicted 198
8 SASI_Rn01_00081332 predicted 884
9 SASI_Rn01_00081333 predicted 249
10 SASI_Rn01_00081334 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058730 predicted 1497
2 SASI_Mm01_00058731 predicted 1802
3 SASI_Mm01_00058732 predicted 1250
4 SASI_Mm01_00058733 predicted 1600
5 SASI_Mm01_00058735 predicted 480
6 SASI_Mm01_00058736 predicted 1424
7 SASI_Mm01_00058737 predicted 1438
8 SASI_Mm01_00058738 predicted 1770
9 SASI_Mm01_00058739 predicted 1529
10 SASI_Mm02_00313554 predicted 1030
11 SASI_Mm01_00058734 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000861
VALIDATED
HRH1 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000861
VALIDATED
HRH1 MISSION shRNA shRNA Plasmid DNA
histamine receptor H1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000861
VALIDATED
HRH1 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008285
HRH1 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008285
HRH1 MISSION shRNA shRNA Plasmid DNA
histamine receptor H1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008285
HRH1 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)