EMAIL THIS PAGE TO A FRIEND

HRH1

histamine receptor H1

253 Gene Product Result for
Synonyms: H1-R hisH1
UniProtKB ID: P35367, A8K047, Q6P9E5
Gene ID:
Human(3269) Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene was thought to be intronless until recently. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(15465) histamine receptor H1
Rat(24448) histamine receptor H 1
Zebrafish(735302) histamine receptor H1
dog(403813) histamine receptor H1
domestic cat(101088314) histamine receptor H1
cow(281231) histamine receptor H1
Horse(100034110) histamine receptor H1
chicken(100858928) histamine receptor H1
domestic guinea pig(100135539) histamine receptor H1
domestic guinea pig(100730517) histamine receptor H1
naked mole-rat(101715481) histamine receptor H1
sheep(101121717) histamine receptor H1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M28804 2-(2-Methylaminoethyl)pyridine 97% human pricing
293490 2-Benzylimidazoline 99% human pricing
B4638 Betahistine dihydrochloride ≥98% human pricing
Y0000391 Betahistine dihydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP824 Betahistine dihydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
155179 Betahistine dihydrochloride 97% human pricing
1065618 Betahistine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR2097 Betahistine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
59964 Histamine analytical standard human pricing
V900396 Histamine Vetec reagent grade, ≥97% human pricing
Y0001779 Histamine European Pharmacopoeia (EP) Reference Standard human pricing
H7250 Histamine dihydrochloride ≥99% (TLC), powder human pricing
53300 Histamine dihydrochloride ≥99.0% (AT) human pricing
1309009 Histamine dihydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
H0600000 Histamine dihydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
V900411 Histamine dihydrochloride Vetec reagent grade, 98% human pricing
13-1130 Histamine dihydrochloride SAJ special grade, ≥98.0% human pricing
53302 Histamine dihydrochloride tested according to Ph Eur human pricing
1669004 Tolazoline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
B1153000 (±)-Brompheniramine maleate salt European Pharmacopoeia (EP) Reference Standard human pricing
C3025 (±)-Chlorpheniramine maleate salt ≥99% (perchloric acid titration) human pricing
B5275 (+)-Brompheniramine maleate salt human pricing
62881 2-[(RS)-(4-Bromophenyl)phenylmethoxy]-N,N-dimethylethanamine hydrochloride pharmaceutical impurity standard human pricing
280550 4-Diphenylmethoxy-1-methylpiperidine hydrochloride 95% human pricing
SML0119 Acrivastine ≥98% (HPLC) human pricing
SML1590 Alcaftadine ≥98% (HPLC) human pricing
A9899 Antazoline hydrochloride human pricing
A1210000 Antazoline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1038003 Antazoline phosphate United States Pharmacopeia (USP) Reference Standard human pricing
A3766 Antazoline phosphate salt analytical standard, for drug analysis human pricing
A2861 Astemizole ≥98% (HPLC) human pricing
1044301 Astemizole United States Pharmacopeia (USP) Reference Standard human pricing
A7611 Azelastine hydrochloride ≥98% (HPLC) human pricing
1046158 Azelastine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000326 Azelastine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1636 Azelastine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1077005 Bromodiphenhydramine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
PHR1861 Bromodiphenhydramine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1078008 Brompheniramine maleate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1864 Brompheniramine Maleate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
B-043 Brompheniramine maleate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
SML1591 Buclizine dihydrochloride ≥98% (HPLC) human pricing
1096000 Carbinoxamine maleate United States Pharmacopeia (USP) Reference Standard human pricing
C8278 Carbinoxamine maleate salt analytical standard human pricing
89126 Cetirizin dihydrochloride ≥98.0% (HPLC) human pricing
C3618 Cetirizine dihydrochloride ≥98% (HPLC) human pricing
1102929 Cetirizine dihydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C0980650 Cetirizine dihydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C-158 Cetirizine dihydrochloride solution 1.0 mg/mL in acetonitrile: water (9:1) (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001197 Cetirizine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
BP837 Cetirizine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
PHR1656 Cetirizine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
BP1081 Cetirizine impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
C1800000 Chlorphenamine maleate European Pharmacopoeia (EP) Reference Standard human pricing
BP081 Chlorphenamine maleate British Pharmacopoeia (BP) Reference Standard human pricing
1123000 Chlorpheniramine maleate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1016 Chlorpheniramine Maleate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
C-036 Chlorpheniramine maleate salt solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
C8138 Chlorpromazine hydrochloride ≥98% (TLC) human pricing
C2180000 Cinnarizine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001613 Clemastine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1134506 Clemastine fumarate United States Pharmacopeia (USP) Reference Standard human pricing
BP525 Clemastine fumarate British Pharmacopoeia (BP) Reference Standard human pricing
C2223000 Clemastine fumarate European Pharmacopoeia (EP) Reference Standard human pricing
SML0445 Clemastine fumarate salt ≥98% (HPLC) human pricing
C6022 Cyproheptadine hydrochloride sesquihydrate ≥98% (TLC), solid human pricing
D1069 Desloratadine powder, ≥98% (HPLC) human pricing
1173042 Desloratadine United States Pharmacopeia (USP) Reference Standard human pricing
Y0001584 Desloratadine European Pharmacopoeia (EP) Reference Standard human pricing
Y0001582 Desloratadine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1680 Desloratidine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1178002 Dexbrompheniramine maleate United States Pharmacopeia (USP) Reference Standard human pricing
1179005 Dexchlorpheniramine maleate United States Pharmacopeia (USP) Reference Standard human pricing
D0720800 Dexchlorpheniramine maleate European Pharmacopoeia (EP) Reference Standard human pricing
D2396 Dimenhydrinate human pricing
PHR1658 Dimenhydrinate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1206006 Dimenhydrinate United States Pharmacopeia (USP) Reference Standard human pricing
D2000000 Dimenhydrinate European Pharmacopoeia (EP) Reference Standard human pricing
Y0001103 Dimenhydrinate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
D3630 Diphenhydramine hydrochloride ≥98% (HPLC) human pricing
PHR1015 Diphenhydramine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
BP896 Diphenhydramine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
D2600000 Diphenhydramine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1218005 Diphenhydramine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
D7774 Diphenhydramine hydrochloride analytical standard human pricing
D-015 Diphenhydramine hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
D4526 Doxepin hydrochloride ~85% E-isomer basis, ≥98% (GC), 15% Z-isomer basis, powder human pricing
Y0001492 Doxylamine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0001562 Doxylamine hydrogen succinate European Pharmacopoeia (EP) Reference Standard human pricing
1227006 Doxylamine succinate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1420 Doxylamine Succinate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
D3775 Doxylamine succinate salt human pricing
D-045 Doxylamine succinate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
E5156 Epinastine hydrochloride ≥98% (HPLC), solid human pricing
1236889 Epinastine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0001139 Epinastine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0001128 Epinastine hydrochloride for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
F6145 Fenspiride hydrochloride analytical standard, for drug analysis human pricing
PHR1685 Fexofenadine HCl Pharmaceutical Secondary Standard; Certified Reference Material human pricing
F9427 Fexofenadine hydrochloride >98% (HPLC) human pricing
1270377 Fexofenadine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP1095 Fexofenadine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
Y0000789 Fexofenadine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP1096 Fexofenadine impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
F4765 Fluphenazine dihydrochloride human pricing
H8885 Hydroxyzine dihydrochloride ≥98% human pricing
PHR1607 Hydroxyzine Dihydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
H-124 Hydroxyzine dihydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
1333003 Hydroxyzine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
H1435000 Hydroxyzine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP841 Hydroxyzine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1334006 Hydroxyzine pamoate United States Pharmacopeia (USP) Reference Standard human pricing
H9010 Hydroxyzine pamoate salt analytical standard human pricing
Y0001617 Ketotifen for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
K2628 Ketotifen fumarate salt human pricing
Y0001619 Ketotifen hydrogen fumarate European Pharmacopoeia (EP) Reference Standard human pricing
Y0001637 Levocabastine for system suitability 2 European Pharmacopoeia (EP) Reference Standard human pricing
L3042 Levocabastine hydrochloride ≥99% (HPLC), solid human pricing
1359856 Levocabastine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0390000 Levocabastine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
L7795 Levocetirizine dihydrochloride ≥98% (HPLC) human pricing
PHR1376 Loratadine Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1370270 Loratadine United States Pharmacopeia (USP) Reference Standard human pricing
BP874 Loratadine British Pharmacopoeia (BP) Reference Standard human pricing
Y0000688 Loratadine European Pharmacopoeia (EP) Reference Standard human pricing
Y0000603 Loratadine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP875 Loratadine impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
1370280 Loratadine Related Compound A United States Pharmacopeia (USP) Reference Standard human pricing
M0220000 Meclozine dihydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP220 Meclozine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
M0500000 Mepyramine maleate European Pharmacopoeia (EP) Reference Standard human pricing
442641 Methapyrilene HCl analytical standard human pricing
1478403 Olopatadine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
O0391 Olopatadine hydrochloride ≥98% (HPLC) human pricing
Y0001181 Orphenadrine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
75517 Orphenadrine hydrochloride ≥98.0% (AT) human pricing
Y0000100 Orphenadrine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
SML1587 Perlapine ≥98% (HPLC) human pricing
1522301 Pheniramine maleate United States Pharmacopeia (USP) Reference Standard human pricing
P0850000 Pheniramine maleate European Pharmacopoeia (EP) Reference Standard human pricing
P6902 Pheniramine maleate salt human pricing
P-045 Pheniramine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0000797 Promethazine for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P4651 Promethazine hydrochloride human pricing
P3400000 Promethazine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1570009 Promethazine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
46682 Promethazine hydrochloride VETRANAL®, analytical standard human pricing
BP412 Promethazine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P-044 Promethazine hydrochloride vial of 25 mg, certified reference material, Cerilliant® human pricing
PHR1467 Promethazine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
PHR1340 Pyrilamine maleate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1588004 Pyrilamine maleate United States Pharmacopeia (USP) Reference Standard human pricing
P5514 Pyrilamine maleate salt human pricing
P5800 Pyrilamine maleate salt human pricing
C4915 S-(+)-Chlorpheniramine maleate salt human pricing
BP650 Terfenadine British Pharmacopoeia (BP) Reference Standard human pricing
T0071000 Terfenadine European Pharmacopoeia (EP) Reference Standard human pricing
1643805 Terfenadine United States Pharmacopeia (USP) Reference Standard human pricing
T-904 Trimipramine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T7511 Tripelennamine hydrochloride analytical standard human pricing
1695004 Tripelennamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
T6764 Triprolidine hydrochloride ≥99% human pricing
BP347 Triprolidine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
T1427 Triprolidine hydrochloride Sigma Reference Standard human pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
T9652 Terfenadine human, mouse, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
H7125 Histamine ≥97.0% human, rat pricing
53290 Histamine base, ≥97.0% (NT) human, rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H7625 D-Histidine monohydrochloride monohydrate ≥98% (TLC) human, mouse, rat pricing
H6647 L-Histidinol dihydrochloride ≥98 (TLC) human, mouse, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C5270 Cinnarizine powder human pricing
L9664 Loratadine ≥98% (HPLC), powder human, rat pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
M4910 1-Methylhistamine dihydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
A55306 2-(2-Pyridyl)ethylamine 95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000861 Rosetta Predictions human pricing
NM_001098211 Rosetta Predictions human pricing
NM_001098212 Rosetta Predictions human pricing
NM_001098213 Rosetta Predictions human pricing
NM_017018 Rosetta Predictions rat pricing
NM_008285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204537 predicted 808
2 SASI_Hs01_00204538 predicted 1235
3 SASI_Hs01_00204539 predicted 1631
4 SASI_Hs01_00204540 predicted 1326
5 SASI_Hs01_00204541 predicted 1099
6 SASI_Hs01_00204542 predicted 1378
7 SASI_Hs02_00303379 predicted 1093
8 SASI_Hs01_00204543 predicted 1504
9 SASI_Hs02_00303380 predicted 1621
10 SASI_Hs01_00204544 predicted 1374
11 SASI_Hs01_00204545 predicted 1302
12 SASI_Hs01_00204546 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318718 predicted 733
2 SASI_Hs02_00318719 predicted 1160
3 SASI_Hs02_00318720 predicted 1561
4 SASI_Hs02_00318721 predicted 1241
5 SASI_Hs02_00318722 predicted 1018
6 SASI_Hs02_00318723 predicted 1307
7 SASI_Hs02_00318724 predicted 1011
8 SASI_Hs02_00318725 predicted 1431
9 SASI_Hs02_00318726 predicted 1537
10 SASI_Hs02_00318727 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318728 predicted 683
2 SASI_Hs02_00318729 predicted 1102
3 SASI_Hs02_00318730 predicted 1509
4 SASI_Hs02_00318731 predicted 1192
5 SASI_Hs02_00318732 predicted 970
6 SASI_Hs02_00318733 predicted 1254
7 SASI_Hs02_00318734 predicted 963
8 SASI_Hs02_00318735 predicted 1375
9 SASI_Hs02_00318736 predicted 1489
10 SASI_Hs02_00318737 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318738 predicted 958
2 SASI_Hs02_00318739 predicted 1384
3 SASI_Hs02_00318740 predicted 1783
4 SASI_Hs02_00318741 predicted 1471
5 SASI_Hs02_00318742 predicted 1243
6 SASI_Hs02_00318743 predicted 1535
7 SASI_Hs02_00318744 predicted 1243
8 SASI_Hs02_00318745 predicted 1662
9 SASI_Hs02_00318746 predicted 1774
10 SASI_Hs02_00318747 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081325 predicted 722
2 SASI_Rn01_00081326 predicted 1131
3 SASI_Rn01_00081327 predicted 1001
4 SASI_Rn01_00081328 predicted 715
5 SASI_Rn01_00081329 predicted 888
6 SASI_Rn01_00081330 predicted 886
7 SASI_Rn01_00081331 predicted 198
8 SASI_Rn01_00081332 predicted 884
9 SASI_Rn01_00081333 predicted 249
10 SASI_Rn01_00081334 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058730 predicted 1497
2 SASI_Mm01_00058731 predicted 1802
3 SASI_Mm01_00058732 predicted 1250
4 SASI_Mm01_00058733 predicted 1600
5 SASI_Mm01_00058735 predicted 480
6 SASI_Mm01_00058736 predicted 1424
7 SASI_Mm01_00058737 predicted 1438
8 SASI_Mm01_00058738 predicted 1770
9 SASI_Mm01_00058739 predicted 1529
10 SASI_Mm02_00313554 predicted 1030
11 SASI_Mm01_00058734 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000861
VALIDATED
HRH1 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000861
VALIDATED
HRH1 MISSION shRNA shRNA Plasmid DNA
histamine receptor H1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000861
VALIDATED
HRH1 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-868s1c1
Sequence:CCGGCCTCCCTTCCTTCTCAGAAATCTCGAGATTTCTGAGAAGGAAGGGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-412s1c1
Sequence:CCGGCGTCGTCATGCCTATGAACATCTCGAGATGTTCATAGGCATGACGACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000861.2-1365s1c1
Sequence:CCGGCGCATTCAAGACAGTATGTATCTCGAGATACATACTGTCTTGAATGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1466s21c1
Sequence:CCGGCCTCTGCTGGATCCCTTATTTCTCGAGAAATAAGGGATCCAGCAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000861.3-3815s21c1
Sequence:CCGGAGTGGCTAAGTGTCCATTATTCTCGAGAATAATGGACACTTAGCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000009063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-796s1c1
Sequence:CCGGGCTCTGGTTCTATGCCAAGATCTCGAGATCTTGGCATAGAACCAGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000861.2-2260s1c1
Sequence:CCGGCCCTGGAAATTCTGCCTTATTCTCGAGAATAAGGCAGAATTTCCAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000284355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-856s21c1
Sequence:CCGGAGCACCGGGAGCTCATCAATACTCGAGTATTGATGAGCTCCCGGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1092s21c1
Sequence:CCGGTACTGCTTTCCACTTGATATTCTCGAGAATATCAAGTGGAAAGCAGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000271226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000861.3-1299s21c1
Sequence:CCGGGCACCAGGCAAAGGCAAATTGCTCGAGCAATTTGCCTTTGCCTGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008285
HRH1 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008285
HRH1 MISSION shRNA shRNA Plasmid DNA
histamine receptor H1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008285
HRH1 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1533s1c1
Sequence:CCGGGATTCCCTATTTCATCTTCTTCTCGAGAAGAAGATGAAATAGGGAATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-490s1c1
Sequence:CCGGCCCATGAACATCCTCTATCTTCTCGAGAAGATAGAGGATGTTCATGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-1591s1c1
Sequence:CCGGCCTGTGCACATGTTCACCATTCTCGAGAATGGTGAACATGTGCACAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-864s1c1
Sequence:CCGGGCTGTGGTTCTATGTGAAGATCTCGAGATCTTCACATAGAACCACAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008285.2-715s1c1
Sequence:CCGGCTGTGGGTTATACCTATACTTCTCGAGAAGTATAGGTATAACCCACAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-706s21c1
Sequence:CCGGTCTCCTTCCTGTGGGTTATACCTCGAGGTATAACCCACAGGAAGGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-1488s21c1
Sequence:CCGGGCCAAGCAGTTGGGTTGTATCCTCGAGGATACAACCCAACTGCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008285.3-2906s21c1
Sequence:GTACCGGATCTGTCCAAACGAGATATTTCTCGAGAAATATCTCGTTTGGACAGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000229454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008285.3-550s21c1
Sequence:CCGGTTTGGCTCTCTATGGATTATGCTCGAGCATAATCCATAGAGAGCCAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???