EMAIL THIS PAGE TO A FRIEND

HRH3

histamine receptor H3

101 Gene Product Result for
Synonyms: GPCR97 HH3R
UniProtKB ID: Q9Y5N1, Q4QRI7, Q9GZX2, Q9H4K8
Gene ID:
Human(11255) Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
Mouse(99296) histamine receptor H3
Rat(85268) histamine receptor H3
Zebrafish(561773) histamine receptor H3
cow(789851) histamine receptor H3
domestic cat(101084437) histamine receptor H3
dog(477282) histamine receptor H3
chicken(428147) histamine receptor H3
domestic guinea pig(100135541) histamine receptor H3
sheep(101121700) histamine receptor H3
Domestic Rabbit(100009035) histamine receptor H3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H7125 Histamine ≥97.0% human, rat pricing
53290 Histamine base, ≥97.0% (NT) human, rat pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
M4910 1-Methylhistamine dihydrochloride ≥98% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141391 MISSION® esiRNA esiRNA human HRH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007232 Rosetta Predictions human pricing
NM_053506 Rosetta Predictions rat pricing
NM_133849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072570 predicted 951
2 SASI_Hs01_00072571 predicted 1300
3 SASI_Hs01_00072572 predicted 1411
4 SASI_Hs02_00343237 predicted 935
5 SASI_Hs01_00072573 predicted 1460
6 SASI_Hs01_00072574 predicted 1330
7 SASI_Hs01_00072575 predicted 1376
8 SASI_Hs01_00072576 predicted 852
9 SASI_Hs01_00072577 predicted 1231
10 SASI_Hs01_00072579 predicted 894
11 SASI_Hs01_00072578 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106894 predicted 975
2 SASI_Rn01_00106895 predicted 840
3 SASI_Rn01_00106896 predicted 361
4 SASI_Rn01_00106897 predicted 1266
5 SASI_Rn01_00106898 predicted 894
6 SASI_Rn01_00106899 predicted 855
7 SASI_Rn01_00106901 predicted 459
8 SASI_Rn01_00106902 predicted 974
9 SASI_Rn02_00266115 predicted 1689
10 SASI_Rn01_00106903 predicted 722
11 SASI_Rn01_00106900 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172936 predicted 719
2 SASI_Mm02_00338885 predicted 532
3 SASI_Mm01_00172937 predicted 1723
4 SASI_Mm01_00172939 predicted 642
5 SASI_Mm01_00172940 predicted 1598
6 SASI_Mm01_00172941 predicted 587
7 SASI_Mm01_00172943 predicted 455
8 SASI_Mm02_00338886 predicted 328
9 SASI_Mm01_00172944 predicted 1315
10 SASI_Mm01_00172945 predicted 465
11 SASI_Mm01_00172938 predicted 1023
12 SASI_Mm01_00172942 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007232
HRH3 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-661s1c1
Sequence:CCGGTGCCTTCAACATCGTGCTCATCTCGAGATGAGCACGATGTTGAAGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-1464s1c1
Sequence:CCGGTCCCTGACTACTGGTACGAAACTCGAGTTTCGTACCAGTAGTCAGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-454s1c1
Sequence:CCGGCGCGCTGGTCATGCTCGCCTTCTCGAGAAGGCGAGCATGACCAGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-862s1c1
Sequence:CCGGCTATGCCGAGTTCTTCTACAACTCGAGTTGTAGAAGAACTCGGCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-902s21c1
Sequence:CCGGCTTCCACCCTGGAGTTCTTTACTCGAGTAAAGAACTCCAGGGTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007232.1-2098s1c1
Sequence:CCGGCTGCCTTCTGTCTCTTGCATACTCGAGTATGCAAGAGACAGAAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007232.2-1746s21c1
Sequence:CCGGGTCTGTGGCCCTCTCTTAATGCTCGAGCATTAAGAGAGGGCCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-929s21c1
Sequence:CCGGTCCTCAGCGTCACCTTCTTTACTCGAGTAAAGAAGGTGACGCTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-1379s21c1
Sequence:CCGGCCGTCATCGTGAGCATCTTTGCTCGAGCAAAGATGCTCACGATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007232
HRH3 MISSION shRNA shRNA Plasmid DNA
histamine receptor H3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-661s1c1
Sequence:CCGGTGCCTTCAACATCGTGCTCATCTCGAGATGAGCACGATGTTGAAGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-1464s1c1
Sequence:CCGGTCCCTGACTACTGGTACGAAACTCGAGTTTCGTACCAGTAGTCAGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-454s1c1
Sequence:CCGGCGCGCTGGTCATGCTCGCCTTCTCGAGAAGGCGAGCATGACCAGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-862s1c1
Sequence:CCGGCTATGCCGAGTTCTTCTACAACTCGAGTTGTAGAAGAACTCGGCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-902s21c1
Sequence:CCGGCTTCCACCCTGGAGTTCTTTACTCGAGTAAAGAACTCCAGGGTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007232.1-2098s1c1
Sequence:CCGGCTGCCTTCTGTCTCTTGCATACTCGAGTATGCAAGAGACAGAAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007232.2-1746s21c1
Sequence:CCGGGTCTGTGGCCCTCTCTTAATGCTCGAGCATTAAGAGAGGGCCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-929s21c1
Sequence:CCGGTCCTCAGCGTCACCTTCTTTACTCGAGTAAAGAAGGTGACGCTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-1379s21c1
Sequence:CCGGCCGTCATCGTGAGCATCTTTGCTCGAGCAAAGATGCTCACGATGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007232
HRH3 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-661s1c1
Sequence:CCGGTGCCTTCAACATCGTGCTCATCTCGAGATGAGCACGATGTTGAAGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-1464s1c1
Sequence:CCGGTCCCTGACTACTGGTACGAAACTCGAGTTTCGTACCAGTAGTCAGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-454s1c1
Sequence:CCGGCGCGCTGGTCATGCTCGCCTTCTCGAGAAGGCGAGCATGACCAGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007232.1-862s1c1
Sequence:CCGGCTATGCCGAGTTCTTCTACAACTCGAGTTGTAGAAGAACTCGGCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-902s21c1
Sequence:CCGGCTTCCACCCTGGAGTTCTTTACTCGAGTAAAGAACTCCAGGGTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007232.1-2098s1c1
Sequence:CCGGCTGCCTTCTGTCTCTTGCATACTCGAGTATGCAAGAGACAGAAGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007232.2-1746s21c1
Sequence:CCGGGTCTGTGGCCCTCTCTTAATGCTCGAGCATTAAGAGAGGGCCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-929s21c1
Sequence:CCGGTCCTCAGCGTCACCTTCTTTACTCGAGTAAAGAAGGTGACGCTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007232.2-1379s21c1
Sequence:CCGGCCGTCATCGTGAGCATCTTTGCTCGAGCAAAGATGCTCACGATGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133849
HRH3 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-462s21c1
Sequence:CCGGCTGATCAGCTATGACCGATTCCTCGAGGAATCGGTCATAGCTGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-279s1c1
Sequence:CCGGCGCACCCAGAACAACTTCTTTCTCGAGAAAGAAGTTGTTCTGGGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-336s1c1
Sequence:CCGGGCCTTCTGCATCCCATTGTATCTCGAGATACAATGGGATGCAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1089s1c1
Sequence:CCGGCGCATGAAGATGGTATCCCAACTCGAGTTGGGATACCATCTTCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133849.1-1981s1c1
Sequence:CCGGGCTCTTCCATTCTGGATGTTTCTCGAGAAACATCCAGAATGGAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1164s1c1
Sequence:CCGGGCTATCATCGTGAGCATCTTTCTCGAGAAAGATGCTCACGATGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-1053s21c1
Sequence:CCGGTCCAAGCCATCAGCGTCTTCACTCGAGTGAAGACGCTGATGGCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133849.2-1705s21c1
Sequence:CCGGTGTCCTCCTTTGCATACTTAGCTCGAGCTAAGTATGCAAAGGAGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133849
HRH3 MISSION shRNA shRNA Plasmid DNA
histamine receptor H3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-462s21c1
Sequence:CCGGCTGATCAGCTATGACCGATTCCTCGAGGAATCGGTCATAGCTGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-279s1c1
Sequence:CCGGCGCACCCAGAACAACTTCTTTCTCGAGAAAGAAGTTGTTCTGGGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-336s1c1
Sequence:CCGGGCCTTCTGCATCCCATTGTATCTCGAGATACAATGGGATGCAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1089s1c1
Sequence:CCGGCGCATGAAGATGGTATCCCAACTCGAGTTGGGATACCATCTTCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133849.1-1981s1c1
Sequence:CCGGGCTCTTCCATTCTGGATGTTTCTCGAGAAACATCCAGAATGGAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1164s1c1
Sequence:CCGGGCTATCATCGTGAGCATCTTTCTCGAGAAAGATGCTCACGATGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-1053s21c1
Sequence:CCGGTCCAAGCCATCAGCGTCTTCACTCGAGTGAAGACGCTGATGGCTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133849.2-1705s21c1
Sequence:CCGGTGTCCTCCTTTGCATACTTAGCTCGAGCTAAGTATGCAAAGGAGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133849
HRH3 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-462s21c1
Sequence:CCGGCTGATCAGCTATGACCGATTCCTCGAGGAATCGGTCATAGCTGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-279s1c1
Sequence:CCGGCGCACCCAGAACAACTTCTTTCTCGAGAAAGAAGTTGTTCTGGGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-336s1c1
Sequence:CCGGGCCTTCTGCATCCCATTGTATCTCGAGATACAATGGGATGCAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1089s1c1
Sequence:CCGGCGCATGAAGATGGTATCCCAACTCGAGTTGGGATACCATCTTCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133849.1-1981s1c1
Sequence:CCGGGCTCTTCCATTCTGGATGTTTCTCGAGAAACATCCAGAATGGAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133849.1-1164s1c1
Sequence:CCGGGCTATCATCGTGAGCATCTTTCTCGAGAAAGATGCTCACGATGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133849.2-1053s21c1
Sequence:CCGGTCCAAGCCATCAGCGTCTTCACTCGAGTGAAGACGCTGATGGCTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133849.2-1705s21c1
Sequence:CCGGTGTCCTCCTTTGCATACTTAGCTCGAGCTAAGTATGCAAAGGAGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)