EMAIL THIS PAGE TO A FRIEND

HRH4

histamine receptor H4

68 Gene Product Result for
Synonyms: AXOR35 BG26 GPCR105 GPRv53 H4 H4R HH4R
UniProtKB ID: Q9H3N8, B0YJ19, B2KJ48, Q4G0I6, Q9GZQ0
Gene ID:
Human(59340) Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(225192) histamine receptor H4
Rat(170704) histamine receptor H4
sheep(101118153) histamine receptor H4
domestic guinea pig(100379272) histamine receptor H4
naked mole-rat(101708797) histamine receptor H4
chicken(769106) histamine receptor H4
domestic cat(101100602) histamine receptor H4
cow(783354) histamine receptor H4
Horse(100034111) histamine receptor H4
dog(490512) histamine receptor H4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
H7125 Histamine ≥97.0% human, rat pricing
53290 Histamine base, ≥97.0% (NT) human, rat pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
M4910 1-Methylhistamine dihydrochloride ≥98% (TLC), powder human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
C6305 Clozapine human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153641 MISSION® esiRNA esiRNA human HRH4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021624 Rosetta Predictions human pricing
NM_131909 Rosetta Predictions rat pricing
NM_153087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166848 predicted 545
2 SASI_Hs01_00166849 predicted 964
3 SASI_Hs01_00166850 predicted 1047
4 SASI_Hs01_00166852 predicted 1032
5 SASI_Hs01_00166853 predicted 366
6 SASI_Hs02_00354973 predicted 566
7 SASI_Hs01_00166854 predicted 1100
8 SASI_Hs01_00166855 predicted 1030
9 SASI_Hs01_00166856 predicted 228
10 SASI_Hs01_00166857 predicted 445
11 SASI_Hs01_00166851 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045171 predicted 845
2 SASI_Rn01_00045172 predicted 301
3 SASI_Rn01_00045173 predicted 478
4 SASI_Rn01_00045174 predicted 985
5 SASI_Rn01_00045175 predicted 1111
6 SASI_Rn01_00045176 predicted 345
7 SASI_Rn01_00045177 predicted 534
8 SASI_Rn01_00045178 predicted 565
9 SASI_Rn01_00045179 predicted 1081
10 SASI_Rn02_00267537 predicted 970
11 SASI_Rn01_00045170 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192887 predicted 235
2 SASI_Mm01_00192888 predicted 444
3 SASI_Mm01_00192889 predicted 330
4 SASI_Mm01_00192890 predicted 1027
5 SASI_Mm01_00192891 predicted 634
6 SASI_Mm01_00192892 predicted 1012
7 SASI_Mm02_00342931 predicted 1023
8 SASI_Mm01_00192894 predicted 765
9 SASI_Mm01_00192895 predicted 1141
10 SASI_Mm01_00192896 predicted 1313
11 SASI_Mm01_00192893 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021624
HRH4 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-238s21c1
Sequence:CCGGTAGACATCGAAGTAGTTATTTCTCGAGAAATAACTACTTCGATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-658s21c1
Sequence:CCGGAGTCATCTTAGTCGCTTATTTCTCGAGAAATAAGCGACTAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021624.3-1301s21c1
Sequence:CCGGTAGTCTCAATCTCACCTAAATCTCGAGATTTAGGTGAGATTGAGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021624.2-1398s1c1
Sequence:CCGGCCAGTGAATAATAGCAGTATACTCGAGTATACTGCTATTATTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-138s1c1
Sequence:CCGGGCACTCGTGTTACTTTAGCATCTCGAGATGCTAAAGTAACACGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-1052s1c1
Sequence:CCGGCCATATTCTCTGTTCACAATTCTCGAGAATTGTGAACAGAGAATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-656s1c1
Sequence:CCGGCCAGTCATCTTAGTCGCTTATCTCGAGATAAGCGACTAAGATGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-455s1c1
Sequence:CCGGGCTGTGTCTTATAGAACTCAACTCGAGTTGAGTTCTATAAGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021624
HRH4 MISSION shRNA shRNA Plasmid DNA
histamine receptor H4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-238s21c1
Sequence:CCGGTAGACATCGAAGTAGTTATTTCTCGAGAAATAACTACTTCGATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-658s21c1
Sequence:CCGGAGTCATCTTAGTCGCTTATTTCTCGAGAAATAAGCGACTAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021624.3-1301s21c1
Sequence:CCGGTAGTCTCAATCTCACCTAAATCTCGAGATTTAGGTGAGATTGAGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021624.2-1398s1c1
Sequence:CCGGCCAGTGAATAATAGCAGTATACTCGAGTATACTGCTATTATTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-138s1c1
Sequence:CCGGGCACTCGTGTTACTTTAGCATCTCGAGATGCTAAAGTAACACGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-1052s1c1
Sequence:CCGGCCATATTCTCTGTTCACAATTCTCGAGAATTGTGAACAGAGAATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-656s1c1
Sequence:CCGGCCAGTCATCTTAGTCGCTTATCTCGAGATAAGCGACTAAGATGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-455s1c1
Sequence:CCGGGCTGTGTCTTATAGAACTCAACTCGAGTTGAGTTCTATAAGACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021624
HRH4 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-238s21c1
Sequence:CCGGTAGACATCGAAGTAGTTATTTCTCGAGAAATAACTACTTCGATGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021624.3-658s21c1
Sequence:CCGGAGTCATCTTAGTCGCTTATTTCTCGAGAAATAAGCGACTAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021624.3-1301s21c1
Sequence:CCGGTAGTCTCAATCTCACCTAAATCTCGAGATTTAGGTGAGATTGAGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021624.2-1398s1c1
Sequence:CCGGCCAGTGAATAATAGCAGTATACTCGAGTATACTGCTATTATTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-138s1c1
Sequence:CCGGGCACTCGTGTTACTTTAGCATCTCGAGATGCTAAAGTAACACGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-1052s1c1
Sequence:CCGGCCATATTCTCTGTTCACAATTCTCGAGAATTGTGAACAGAGAATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-656s1c1
Sequence:CCGGCCAGTCATCTTAGTCGCTTATCTCGAGATAAGCGACTAAGATGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021624.2-455s1c1
Sequence:CCGGGCTGTGTCTTATAGAACTCAACTCGAGTTGAGTTCTATAAGACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153087
HRH4 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-415s1c1
Sequence:CCGGGCTGTGTCTTATAGGGCTCAACTCGAGTTGAGCCCTATAAGACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-1101s1c1
Sequence:CCGGGCTGCAATGGTTCAATTCGTTCTCGAGAACGAATTGAACCATTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-353s1c1
Sequence:CCGGGCACCGCATCTGTCTACAATACTCGAGTATTGTAGACAGATGCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-588s1c1
Sequence:CCGGCCTCACCATTACAATGCTCTTCTCGAGAAGAGCATTGTAATGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153087.1-1245s1c1
Sequence:CCGGGCTTCACGAGTGCCAACTTTACTCGAGTAAAGTTGGCACTCGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153087
HRH4 MISSION shRNA shRNA Plasmid DNA
histamine receptor H4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-415s1c1
Sequence:CCGGGCTGTGTCTTATAGGGCTCAACTCGAGTTGAGCCCTATAAGACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-1101s1c1
Sequence:CCGGGCTGCAATGGTTCAATTCGTTCTCGAGAACGAATTGAACCATTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-353s1c1
Sequence:CCGGGCACCGCATCTGTCTACAATACTCGAGTATTGTAGACAGATGCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-588s1c1
Sequence:CCGGCCTCACCATTACAATGCTCTTCTCGAGAAGAGCATTGTAATGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153087.1-1245s1c1
Sequence:CCGGGCTTCACGAGTGCCAACTTTACTCGAGTAAAGTTGGCACTCGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153087
HRH4 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-415s1c1
Sequence:CCGGGCTGTGTCTTATAGGGCTCAACTCGAGTTGAGCCCTATAAGACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-1101s1c1
Sequence:CCGGGCTGCAATGGTTCAATTCGTTCTCGAGAACGAATTGAACCATTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-353s1c1
Sequence:CCGGGCACCGCATCTGTCTACAATACTCGAGTATTGTAGACAGATGCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153087.1-588s1c1
Sequence:CCGGCCTCACCATTACAATGCTCTTCTCGAGAAGAGCATTGTAATGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153087.1-1245s1c1
Sequence:CCGGGCTTCACGAGTGCCAACTTTACTCGAGTAAAGTTGGCACTCGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)