EMAIL THIS PAGE TO A FRIEND

HRK

harakiri, BCL2 interacting protein (contains only BH3 domain)

54 Gene Product Result for
Synonyms: DP5 HARAKIRI
UniProtKB ID: O00198
Gene ID:
Human(8739) Summary: This gene encodes a member of the BCL-2 protein family. Members of this family are involved in activating or inhibiting apoptosis. The encoded protein localizes to intracellular membranes. This protein promotes apoptosis by interacting with the apoptotic inhibitors BCL-2 and BCL-X(L) via its BH3 domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Mouse(12123) harakiri, BCL2 interacting protein (contains only BH3 domain)
Rat(117271) harakiri, BCL2 interacting protein (contains only BH3 domain)
dog(612984) harakiri, BCL2 interacting protein (contains only BH3 domain)
cow(787139) harakiri, BCL2 interacting protein (contains only BH3 domain)
naked mole-rat(101715325) harakiri, BCL2 interacting protein (contains only BH3 domain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063401 MISSION® esiRNA esiRNA targeting mouse Hrk (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003806 Rosetta Predictions human pricing
NM_057130 Rosetta Predictions rat pricing
NM_007545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336339 predicted 560
2 SASI_Hs01_00234618 predicted 522
3 SASI_Hs02_00336340 predicted 567
4 SASI_Hs01_00234619 predicted 559
5 SASI_Hs01_00234620 predicted 217
6 SASI_Hs01_00234621 predicted 432
7 SASI_Hs01_00234623 predicted 557
8 SASI_Hs01_00234625 predicted 474
9 SASI_Hs01_00234626 predicted 515
10 SASI_Hs01_00234627 predicted 562
11 SASI_Hs01_00234622 predicted 567
12 SASI_Hs01_00234624 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110582 predicted 526
2 SASI_Rn02_00267074 predicted 528
3 SASI_Rn01_00110583 predicted 634
4 SASI_Rn01_00110584 predicted 625
5 SASI_Rn02_00267075 predicted 512
6 SASI_Rn01_00110586 predicted 367
7 SASI_Rn01_00110587 predicted 355
8 SASI_Rn01_00110589 predicted 527
9 SASI_Rn01_00110590 predicted 436
10 SASI_Rn01_00110591 predicted 680
11 SASI_Rn01_00110585 predicted 376
12 SASI_Rn01_00110588 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067846 predicted 628
2 SASI_Mm01_00067847 predicted 526
3 SASI_Mm01_00067848 predicted 432
4 SASI_Mm01_00067849 predicted 636
5 SASI_Mm01_00067851 predicted 748
6 SASI_Mm02_00311884 predicted 368
7 SASI_Mm01_00067852 predicted 423
8 SASI_Mm01_00067854 predicted 352
9 SASI_Mm01_00067855 predicted 617
10 SASI_Mm02_00311885 predicted 511
11 SASI_Mm01_00067850 predicted 387
12 SASI_Mm01_00067853 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003806
VALIDATED
HRK MISSION shRNA Bacterial Glycerol Stock
harakiri, BCL2 interacting protein (contains only BH3 domain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-372s1c1
Sequence:CCGGGCTGCTCGGCAGGCGGAACTTCTCGAGAAGTTCCGCCTGCCGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-375s1c1
Sequence:CCGGGCTCGGCAGGCGGAACTTGTACTCGAGTACAAGTTCCGCCTGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-237s1c1
Sequence:CCGGGCTAGGCGACGAGCTGCACCACTCGAGTGGTGCAGCTCGTCGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-246s1c1
Sequence:CCGGCGAGCTGCACCAGCGCACCATCTCGAGATGGTGCGCTGGTGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-231s1c1
Sequence:CCGGCAAGGCGCTAGGCGACGAGCTCTCGAGAGCTCGTCGCCTAGCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003806
VALIDATED
HRK MISSION shRNA shRNA Plasmid DNA
harakiri, BCL2 interacting protein (contains only BH3 domain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-372s1c1
Sequence:CCGGGCTGCTCGGCAGGCGGAACTTCTCGAGAAGTTCCGCCTGCCGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-375s1c1
Sequence:CCGGGCTCGGCAGGCGGAACTTGTACTCGAGTACAAGTTCCGCCTGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-237s1c1
Sequence:CCGGGCTAGGCGACGAGCTGCACCACTCGAGTGGTGCAGCTCGTCGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-246s1c1
Sequence:CCGGCGAGCTGCACCAGCGCACCATCTCGAGATGGTGCGCTGGTGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-231s1c1
Sequence:CCGGCAAGGCGCTAGGCGACGAGCTCTCGAGAGCTCGTCGCCTAGCGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003806
VALIDATED
HRK MISSION shRNA Lentiviral Transduction Particles
harakiri, BCL2 interacting protein (contains only BH3 domain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-372s1c1
Sequence:CCGGGCTGCTCGGCAGGCGGAACTTCTCGAGAAGTTCCGCCTGCCGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-375s1c1
Sequence:CCGGGCTCGGCAGGCGGAACTTGTACTCGAGTACAAGTTCCGCCTGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-237s1c1
Sequence:CCGGGCTAGGCGACGAGCTGCACCACTCGAGTGGTGCAGCTCGTCGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003806.1-246s1c1
Sequence:CCGGCGAGCTGCACCAGCGCACCATCTCGAGATGGTGCGCTGGTGCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003806.1-231s1c1
Sequence:CCGGCAAGGCGCTAGGCGACGAGCTCTCGAGAGCTCGTCGCCTAGCGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007545
HRK MISSION shRNA Bacterial Glycerol Stock
harakiri, BCL2 interacting protein (contains only BH3 domain)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-518s1c1
Sequence:CCGGCCCAGTGCTATTTAGCTATATCTCGAGATATAGCTAAATAGCACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-431s1c1
Sequence:CCGGGTGGAAGGAAGCAGAATTGTACTCGAGTACAATTCTGCTTCCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-519s21c1
Sequence:CCGGCCAGTGCTATTTAGCTATATACTCGAGTATATAGCTAAATAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.2-2702s1c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-4284s21c1
Sequence:CCGGTATTCACTTGACACCTATTTACTCGAGTAAATAGGTGTCAAGTGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2849s21c1
Sequence:CCGGCTGACTTCTTGACGGACATTTCTCGAGAAATGTCCGTCAAGAAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2702s21c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-899s21c1
Sequence:CCGGTAGATCTCATGGTGGTCATATCTCGAGATATGACCACCATGAGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007545
HRK MISSION shRNA shRNA Plasmid DNA
harakiri, BCL2 interacting protein (contains only BH3 domain)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-518s1c1
Sequence:CCGGCCCAGTGCTATTTAGCTATATCTCGAGATATAGCTAAATAGCACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-431s1c1
Sequence:CCGGGTGGAAGGAAGCAGAATTGTACTCGAGTACAATTCTGCTTCCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-519s21c1
Sequence:CCGGCCAGTGCTATTTAGCTATATACTCGAGTATATAGCTAAATAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.2-2702s1c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-4284s21c1
Sequence:CCGGTATTCACTTGACACCTATTTACTCGAGTAAATAGGTGTCAAGTGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2849s21c1
Sequence:CCGGCTGACTTCTTGACGGACATTTCTCGAGAAATGTCCGTCAAGAAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2702s21c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-899s21c1
Sequence:CCGGTAGATCTCATGGTGGTCATATCTCGAGATATGACCACCATGAGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007545
HRK MISSION shRNA Lentiviral Transduction Particles
harakiri, BCL2 interacting protein (contains only BH3 domain)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-518s1c1
Sequence:CCGGCCCAGTGCTATTTAGCTATATCTCGAGATATAGCTAAATAGCACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192687    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.1-431s1c1
Sequence:CCGGGTGGAAGGAAGCAGAATTGTACTCGAGTACAATTCTGCTTCCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-519s21c1
Sequence:CCGGCCAGTGCTATTTAGCTATATACTCGAGTATATAGCTAAATAGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007545.2-2702s1c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-4284s21c1
Sequence:CCGGTATTCACTTGACACCTATTTACTCGAGTAAATAGGTGTCAAGTGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2849s21c1
Sequence:CCGGCTGACTTCTTGACGGACATTTCTCGAGAAATGTCCGTCAAGAAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-2702s21c1
Sequence:CCGGGTAATGGAAACCACGTATTTACTCGAGTAAATACGTGGTTTCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007545.2-899s21c1
Sequence:CCGGTAGATCTCATGGTGGTCATATCTCGAGATATGACCACCATGAGATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)