EMAIL THIS PAGE TO A FRIEND

HRNR

hornerin

124 Gene Product Result for
Synonyms: FLG3 S100A16 S100a18
UniProtKB ID: Q86YZ3, Q5U1F4
Gene ID:
Mouse(68723) hornerin
cow(788654) hornerin
dog(483208) hornerin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031469 Anti-HRNR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU217331 MISSION® esiRNA esiRNA targeting mouse Hrnr mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009931 Rosetta Predictions human pricing
XM_001726971 Rosetta Predictions human pricing
XM_001000796 Rosetta Predictions mouse pricing
XM_984724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081077 predicted 2296
2 SASI_Hs01_00081078 predicted 1433
3 SASI_Hs01_00081079 predicted 3694
4 SASI_Hs01_00081081 predicted 5969
5 SASI_Hs01_00081082 predicted 5457
6 SASI_Hs01_00081083 predicted 1870
7 SASI_Hs01_00081080 predicted 2644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477764 predicted 2149
2 SASI_Hs02_00477765 predicted 717
3 SASI_Hs02_00477766 predicted 4729
4 SASI_Hs02_00477767 predicted 4933
5 SASI_Hs02_00477768 predicted 4624
6 SASI_Hs02_00477769 predicted 4409
7 SASI_Hs02_00477770 predicted 4920
8 SASI_Hs02_00477771 predicted 4908
9 SASI_Hs02_00477772 predicted 4887
10 SASI_Hs02_00477773 predicted 4807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354815 predicted 9466
2 SASI_Mm02_00354816 predicted 9342
3 SASI_Mm01_00225291 predicted 9015
4 SASI_Mm02_00354817 predicted 9396
5 SASI_Mm02_00354818 predicted 9557
6 SASI_Mm02_00354819 predicted 9540
7 SASI_Mm02_00354820 predicted 9301
8 SASI_Mm02_00354821 predicted 8994
9 SASI_Mm01_00225292 predicted 9202
10 SASI_Mm01_00225293 predicted 8735
11 SASI_Mm01_00225288 predicted 8998
12 SASI_Mm01_00225289 predicted 8791
13 SASI_Mm01_00225290 predicted 9009
14 SASI_Mm01_00225294 predicted 9162
15 SASI_Mm01_00225295 predicted 9099
16 SASI_Mm01_00225296 predicted 9049
17 SASI_Mm01_00225297 predicted 9364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448556 predicted 1329
2 SASI_Mm02_00448557 predicted 1028
3 SASI_Mm02_00448558 predicted 695
4 SASI_Mm02_00448559 predicted 835
5 SASI_Mm02_00448560 predicted 895
6 SASI_Mm02_00448561 predicted 1918
7 SASI_Mm02_00448562 predicted 1032
8 SASI_Mm02_00448563 predicted 2475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009931
HRNR MISSION shRNA Bacterial Glycerol Stock
hornerin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8809s21c1
Sequence:CCGGTCCAAAGACTGTTAGGCATTTCTCGAGAAATGCCTAACAGTCTTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8670s21c1
Sequence:CCGGGAAATAGGAAAGTCATCTATGCTCGAGCATAGATGACTTTCCTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-765s1c1
Sequence:CCGGGCTTTAGTCAACACAAGTCTACTCGAGTAGACTTGTGTTGACTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-9150s1c1
Sequence:CCGGGCAGCGGTAGTGTCTTTACTTCTCGAGAAGTAAAGACACTACCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-8972s1c1
Sequence:CCGGGCCAAAGCTAACCTTACATTTCTCGAGAAATGTAAGGTTAGCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-345s1c1
Sequence:CCGGGCAAAGATTACTGCCAAGTTTCTCGAGAAACTTGGCAGTAATCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-260s1c1
Sequence:CCGGGATCGAGACCATAACAAGAAACTCGAGTTTCTTGTTATGGTCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009931
HRNR MISSION shRNA shRNA Plasmid DNA
hornerin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8809s21c1
Sequence:CCGGTCCAAAGACTGTTAGGCATTTCTCGAGAAATGCCTAACAGTCTTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8670s21c1
Sequence:CCGGGAAATAGGAAAGTCATCTATGCTCGAGCATAGATGACTTTCCTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-765s1c1
Sequence:CCGGGCTTTAGTCAACACAAGTCTACTCGAGTAGACTTGTGTTGACTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-9150s1c1
Sequence:CCGGGCAGCGGTAGTGTCTTTACTTCTCGAGAAGTAAAGACACTACCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-8972s1c1
Sequence:CCGGGCCAAAGCTAACCTTACATTTCTCGAGAAATGTAAGGTTAGCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-345s1c1
Sequence:CCGGGCAAAGATTACTGCCAAGTTTCTCGAGAAACTTGGCAGTAATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-260s1c1
Sequence:CCGGGATCGAGACCATAACAAGAAACTCGAGTTTCTTGTTATGGTCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009931
HRNR MISSION shRNA Lentiviral Transduction Particles
hornerin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8809s21c1
Sequence:CCGGTCCAAAGACTGTTAGGCATTTCTCGAGAAATGCCTAACAGTCTTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009931.1-8670s21c1
Sequence:CCGGGAAATAGGAAAGTCATCTATGCTCGAGCATAGATGACTTTCCTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-765s1c1
Sequence:CCGGGCTTTAGTCAACACAAGTCTACTCGAGTAGACTTGTGTTGACTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-9150s1c1
Sequence:CCGGGCAGCGGTAGTGTCTTTACTTCTCGAGAAGTAAAGACACTACCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009931.1-8972s1c1
Sequence:CCGGGCCAAAGCTAACCTTACATTTCTCGAGAAATGTAAGGTTAGCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-345s1c1
Sequence:CCGGGCAAAGATTACTGCCAAGTTTCTCGAGAAACTTGGCAGTAATCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009931.1-260s1c1
Sequence:CCGGGATCGAGACCATAACAAGAAACTCGAGTTTCTTGTTATGGTCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)