EMAIL THIS PAGE TO A FRIEND

HRSP12

heat-responsive protein 12

55 Gene Product Result for
Synonyms: P14.5 PSP UK114
UniProtKB ID: P52758, Q6FHU9, Q6IBG0
Gene ID:
Mouse(15473) heat-responsive protein 12
Rat(65151) heat-responsive protein 12
Goat(100861379) heat-responsive protein 12
sheep(101106599) heat-responsive protein 12
domestic guinea pig(101787487) heat-responsive protein 12
naked mole-rat(101714052) heat-responsive protein 12
Zebrafish(436849) heat-responsive protein 12
dog(475043) heat-responsive protein 12
cow(504390) heat-responsive protein 12
domestic cat(101093834) heat-responsive protein 12
chicken(426536) heat-responsive protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005836 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005836 Rosetta Predictions human pricing
NM_031714 Rosetta Predictions rat pricing
NM_008287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013321 predicted 522
2 SASI_Hs01_00013322 predicted 380
3 SASI_Hs01_00013323 predicted 204
4 SASI_Hs01_00013324 predicted 625
5 SASI_Hs01_00013325 predicted 509
6 SASI_Hs01_00013326 predicted 417
7 SASI_Hs01_00013327 predicted 323
8 SASI_Hs01_00013328 predicted 444
9 SASI_Hs01_00013329 predicted 297
10 SASI_Hs01_00013330 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030533 predicted 559
2 SASI_Rn01_00030534 predicted 622
3 SASI_Rn01_00030536 predicted 402
4 SASI_Rn01_00030537 predicted 483
5 SASI_Rn01_00030538 predicted 630
6 SASI_Rn01_00030539 predicted 398
7 SASI_Rn01_00030540 predicted 486
8 SASI_Rn01_00030541 predicted 482
9 SASI_Rn01_00030542 predicted 588
10 SASI_Rn02_00265083 predicted 387
11 SASI_Rn01_00030535 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140009 predicted 571
2 SASI_Mm02_00313556 predicted 274
3 SASI_Mm01_00140010 predicted 428
4 SASI_Mm01_00140011 predicted 490
5 SASI_Mm01_00140013 predicted 456
6 SASI_Mm02_00313557 predicted 487
7 SASI_Mm01_00140015 predicted 337
8 SASI_Mm02_00313558 predicted 403
9 SASI_Mm01_00140016 predicted 587
10 SASI_Mm01_00140018 predicted 569
11 SASI_Mm01_00140012 predicted 405
12 SASI_Mm01_00140014 predicted 601
13 SASI_Mm01_00140017 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008287
VALIDATED
HRSP12 MISSION shRNA Bacterial Glycerol Stock
heat-responsive protein 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008287.2-601s1c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-398s1c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-278s1c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-233s1c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-342s1c1
Sequence:CCGGGCACTGTCAATGAGATCTATACTCGAGTATAGATCTCATTGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008287.2-601s21c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-398s21c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-278s21c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-233s21c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008287
VALIDATED
HRSP12 MISSION shRNA shRNA Plasmid DNA
heat-responsive protein 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008287.2-601s1c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-398s1c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-278s1c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-233s1c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-342s1c1
Sequence:CCGGGCACTGTCAATGAGATCTATACTCGAGTATAGATCTCATTGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008287.2-601s21c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-398s21c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-278s21c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-233s21c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008287
VALIDATED
HRSP12 MISSION shRNA Lentiviral Transduction Particles
heat-responsive protein 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008287.2-601s1c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-398s1c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008287.2-278s1c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-233s1c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008287.2-342s1c1
Sequence:CCGGGCACTGTCAATGAGATCTATACTCGAGTATAGATCTCATTGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008287.2-601s21c1
Sequence:CCGGGTGATCAAATATGTGGAGATTCTCGAGAATCTCCACATATTTGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-398s21c1
Sequence:CCGGGCTTACCAAGTCGCTGCTTTACTCGAGTAAAGCAGCGACTTGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-278s21c1
Sequence:CCGGGCAGGCTGTGACTTCAATAATCTCGAGATTATTGAAGTCACAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008287.2-233s21c1
Sequence:CCGGGAAGCTAAACAGGCTCTTAAACTCGAGTTTAAGAGCCTGTTTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005836
VALIDATED
HRSP12 MISSION shRNA Bacterial Glycerol Stock
heat-responsive protein 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-254s21c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-152s1c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-254s1c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-451s1c1
Sequence:CCGGCCGAATTGAAATTGAAGCAGTCTCGAGACTGCTTCAATTTCAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-308s1c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-174s21c1
Sequence:CCGGTCGACAGGACCATTTACATTTCTCGAGAAATGTAAATGGTCCTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-152s21c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-308s21c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-738s21c1
Sequence:CCGGATAGGAAAGAGATACCCATTACTCGAGTAATGGGTATCTCTTTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005836
VALIDATED
HRSP12 MISSION shRNA shRNA Plasmid DNA
heat-responsive protein 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-254s21c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-152s1c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-254s1c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-451s1c1
Sequence:CCGGCCGAATTGAAATTGAAGCAGTCTCGAGACTGCTTCAATTTCAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-308s1c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-174s21c1
Sequence:CCGGTCGACAGGACCATTTACATTTCTCGAGAAATGTAAATGGTCCTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-152s21c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-308s21c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-738s21c1
Sequence:CCGGATAGGAAAGAGATACCCATTACTCGAGTAATGGGTATCTCTTTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005836
VALIDATED
HRSP12 MISSION shRNA Lentiviral Transduction Particles
heat-responsive protein 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-254s21c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-152s1c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-254s1c1
Sequence:CCGGGAAGCTAAACAAGCTCTTAAACTCGAGTTTAAGAGCTTGTTTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-451s1c1
Sequence:CCGGCCGAATTGAAATTGAAGCAGTCTCGAGACTGCTTCAATTTCAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005836.1-308s1c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-174s21c1
Sequence:CCGGTCGACAGGACCATTTACATTTCTCGAGAAATGTAAATGGTCCTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-152s21c1
Sequence:CCGGCCCTACAGTCAAGCTGTATTACTCGAGTAATACAGCTTGACTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-308s21c1
Sequence:CCGGGACTTCACTAACGTGGTGAAACTCGAGTTTCACCACGTTAGTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005836.2-738s21c1
Sequence:CCGGATAGGAAAGAGATACCCATTACTCGAGTAATGGGTATCTCTTTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)