EMAIL THIS PAGE TO A FRIEND

HS1BP3

HCLS1 binding protein 3

103 Gene Product Result for
Synonyms: ETM2 HS1-BP3
UniProtKB ID: Q53T59, B2RAW2, D6W529, Q86VC2, Q8N367
Gene ID:
Human(64342) Summary: The protein encoded by this gene shares similarity with mouse Hs1bp3, an Hcls1/Hs1-interacting protein that may be involved in lymphocyte activation. [provided by RefSeq, Jul 2008]
Mouse(58240) HCLS1 binding protein 3
Rat(313950) HCLS1 binding protein 3
chicken(421966) HCLS1 binding protein 3
domestic cat(101099116) HCLS1 binding protein 3
cow(526092) HCLS1 binding protein 3
dog(610655) HCLS1 binding protein 3
sheep(101107346) HCLS1 binding protein 3
domestic guinea pig(100723469) HCLS1 binding protein 3
naked mole-rat(101699633) HCLS1 binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071331 MISSION® esiRNA esiRNA human HS1BP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022460 Rosetta Predictions human pricing
XM_001071788 Rosetta Predictions rat pricing
XM_233975 Rosetta Predictions rat pricing
NM_021429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165201 predicted 502
2 SASI_Hs01_00165202 predicted 273
3 SASI_Hs01_00165203 predicted 506
4 SASI_Hs01_00165204 predicted 202
5 SASI_Hs01_00165205 predicted 431
6 SASI_Hs02_00355730 predicted 752
7 SASI_Hs02_00355731 predicted 648
8 SASI_Hs01_00165208 predicted 1353
9 SASI_Hs01_00165209 predicted 524
10 SASI_Hs01_00165210 predicted 378
11 SASI_Hs01_00165206 predicted 362
12 SASI_Hs01_00165207 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336480 predicted 1539
2 SASI_Rn02_00336481 predicted 546
3 SASI_Rn02_00336482 predicted 849
4 SASI_Rn02_00336483 predicted 643
5 SASI_Rn02_00336484 predicted 1217
6 SASI_Rn02_00336485 predicted 1716
7 SASI_Rn02_00336486 predicted 1730
8 SASI_Rn02_00336487 predicted 639
9 SASI_Rn02_00336488 predicted 1645
10 SASI_Rn02_00336489 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388160 predicted 1544
2 SASI_Rn02_00388161 predicted 545
3 SASI_Rn02_00388162 predicted 850
4 SASI_Rn02_00388163 predicted 638
5 SASI_Rn02_00388164 predicted 1209
6 SASI_Rn02_00388165 predicted 1720
7 SASI_Rn02_00388166 predicted 1735
8 SASI_Rn02_00388167 predicted 645
9 SASI_Rn02_00388168 predicted 1648
10 SASI_Rn02_00388169 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062905 predicted 1130
2 SASI_Mm02_00326066 predicted 1707
3 SASI_Mm02_00326067 predicted 1677
4 SASI_Mm02_00326068 predicted 1458
5 SASI_Mm02_00326069 predicted 1355
6 SASI_Mm01_00062907 predicted 265
7 SASI_Mm02_00326070 predicted 1177
8 SASI_Mm02_00326071 predicted 1387
9 SASI_Mm01_00062908 predicted 1100
10 SASI_Mm02_00326072 predicted 1487
11 SASI_Mm01_00062906 predicted 362
12 SASI_Mm01_00062909 predicted 1082
13 SASI_Mm01_00062910 predicted 216
14 SASI_Mm01_00062911 predicted 207
15 SASI_Mm01_00062912 predicted 306
16 SASI_Mm01_00062913 predicted 219
17 SASI_Mm01_00062914 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022460
VALIDATED
HS1BP3 MISSION shRNA Bacterial Glycerol Stock
HCLS1 binding protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-1151s21c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-947s21c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-365s21c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-429s21c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-1144s1c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-422s1c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-940s1c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-269s1c1
Sequence:CCGGCAGAAACTGAGCAGTCGTTATCTCGAGATAACGACTGCTCAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-949s1c1
Sequence:CCGGGTTCAGAGTTGAAGAGGACTTCTCGAGAAGTCCTCTTCAACTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-664s1c1
Sequence:CCGGGAAGCCCAAGAAACATCCCAACTCGAGTTGGGATGTTTCTTGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-358s1c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022460
VALIDATED
HS1BP3 MISSION shRNA shRNA Plasmid DNA
HCLS1 binding protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-1151s21c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-947s21c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-365s21c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-429s21c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-1144s1c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-422s1c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-940s1c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-269s1c1
Sequence:CCGGCAGAAACTGAGCAGTCGTTATCTCGAGATAACGACTGCTCAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-949s1c1
Sequence:CCGGGTTCAGAGTTGAAGAGGACTTCTCGAGAAGTCCTCTTCAACTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-664s1c1
Sequence:CCGGGAAGCCCAAGAAACATCCCAACTCGAGTTGGGATGTTTCTTGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-358s1c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022460
VALIDATED
HS1BP3 MISSION shRNA Lentiviral Transduction Particles
HCLS1 binding protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-1151s21c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-947s21c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-365s21c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022460.3-429s21c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-1144s1c1
Sequence:CCGGCGAGATGGACATCTTGCAGTACTCGAGTACTGCAAGATGTCCATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-422s1c1
Sequence:CCGGGAGCTGCTAGAGTTCTTAGGTCTCGAGACCTAAGAACTCTAGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-940s1c1
Sequence:CCGGCAAGGAACTGTTCAGAGTTGACTCGAGTCAACTCTGAACAGTTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-269s1c1
Sequence:CCGGCAGAAACTGAGCAGTCGTTATCTCGAGATAACGACTGCTCAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-949s1c1
Sequence:CCGGGTTCAGAGTTGAAGAGGACTTCTCGAGAAGTCCTCTTCAACTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022460.2-664s1c1
Sequence:CCGGGAAGCCCAAGAAACATCCCAACTCGAGTTGGGATGTTTCTTGGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022460.2-358s1c1
Sequence:CCGGGAGAGCCGTGTTCAATGAGATCTCGAGATCTCATTGAACACGGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021429
HS1BP3 MISSION shRNA Bacterial Glycerol Stock
HCLS1 binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-1156s21c1
Sequence:CCGGATGGACATCTTGCAGTATATCCTCGAGGATATACTGCAAGATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021429.3-2586s21c1
Sequence:CCGGTGAACCCTAGTCCCTTTATATCTCGAGATATAAAGGGACTAGGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-220s21c1
Sequence:CCGGGTCCAGTTCTTGGTCTCTAAACTCGAGTTTAGAGACCAAGAACTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-268s21c1
Sequence:CCGGCAGAAGCTGTACAGTTGTTACCTCGAGGTAACAACTGTACAGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-311s21c1
Sequence:CCGGTGCCTAGGAAGGTCCTGTTTGCTCGAGCAAACAGGACCTTCCTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021429
HS1BP3 MISSION shRNA shRNA Plasmid DNA
HCLS1 binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-1156s21c1
Sequence:CCGGATGGACATCTTGCAGTATATCCTCGAGGATATACTGCAAGATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021429.3-2586s21c1
Sequence:CCGGTGAACCCTAGTCCCTTTATATCTCGAGATATAAAGGGACTAGGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-220s21c1
Sequence:CCGGGTCCAGTTCTTGGTCTCTAAACTCGAGTTTAGAGACCAAGAACTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-268s21c1
Sequence:CCGGCAGAAGCTGTACAGTTGTTACCTCGAGGTAACAACTGTACAGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-311s21c1
Sequence:CCGGTGCCTAGGAAGGTCCTGTTTGCTCGAGCAAACAGGACCTTCCTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021429
HS1BP3 MISSION shRNA Lentiviral Transduction Particles
HCLS1 binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-1156s21c1
Sequence:CCGGATGGACATCTTGCAGTATATCCTCGAGGATATACTGCAAGATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021429.3-2586s21c1
Sequence:CCGGTGAACCCTAGTCCCTTTATATCTCGAGATATAAAGGGACTAGGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-220s21c1
Sequence:CCGGGTCCAGTTCTTGGTCTCTAAACTCGAGTTTAGAGACCAAGAACTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-268s21c1
Sequence:CCGGCAGAAGCTGTACAGTTGTTACCTCGAGGTAACAACTGTACAGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021429.3-311s21c1
Sequence:CCGGTGCCTAGGAAGGTCCTGTTTGCTCGAGCAAACAGGACCTTCCTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)