EMAIL THIS PAGE TO A FRIEND

HS2ST1

heparan sulfate 2-O-sulfotransferase 1

292 Gene Product Result for
Synonyms: dJ604K5.2
Gene ID:
Human(9653) Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(23908) heparan sulfate 2-O-sulfotransferase 1
Rat(292155) heparan sulfate 2-O-sulfotransferase 1
chicken(395140) heparan sulfate 2-O-sulfotransferase 1
domestic cat(101080559) heparan sulfate 2-O-sulfotransferase 1
Horse(100063266) heparan sulfate 2-O-sulfotransferase 1
cow(523780) heparan sulfate 2-O-sulfotransferase 1
dog(479963) heparan sulfate 2-O-sulfotransferase 1
domestic guinea pig(100733278) heparan sulfate 2-O-sulfotransferase 1
naked mole-rat(101706937) heparan sulfate 2-O-sulfotransferase 1
sheep(101117803) heparan sulfate 2-O-sulfotransferase 1
Domestic Rabbit(100352170) heparan sulfate 2-O-sulfotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101042 Anti-HS2ST1 (126-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101079 Anti-HS2ST1 (ab1) antibody produced in rabbit affinity isolated antibody , zebrafish, guinea pig, human, horse, rat, mouse, rabbit
western blot pricing
SAB2101080 Anti-HS2ST1 (ab2) antibody produced in rabbit affinity isolated antibody horse, bovine, rabbit, zebrafish, mouse, human,
western blot pricing
SAB1300413 Anti-HS2ST1 (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1300412 Anti-HS2ST1 (N-term) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1400357 Anti-HS2ST1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA043069 Anti-HS2ST1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043603 Anti-HS2ST1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA075001 Anti-HS2ST1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012262 Rosetta Predictions human pricing
XM_001079125 Rosetta Predictions rat pricing
XM_214740 Rosetta Predictions rat pricing
NM_011828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214049 predicted 1407
2 SASI_Hs01_00214050 predicted 1314
3 SASI_Hs01_00214051 predicted 1437
4 SASI_Hs01_00214052 predicted 1002
5 SASI_Hs01_00214053 predicted 1056
6 SASI_Hs01_00214054 predicted 368
7 SASI_Hs01_00214055 predicted 1239
8 SASI_Hs01_00214056 predicted 1070
9 SASI_Hs02_00343983 predicted 1241
10 SASI_Hs01_00214057 predicted 1503
11 SASI_Hs01_00214048 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363227 predicted 581
2 SASI_Rn02_00363228 predicted 524
3 SASI_Rn02_00363229 predicted 782
4 SASI_Rn02_00363230 predicted 519
5 SASI_Rn02_00363231 predicted 835
6 SASI_Rn02_00363232 predicted 987
7 SASI_Rn02_00363233 predicted 956
8 SASI_Rn02_00363234 predicted 1278
9 SASI_Rn02_00363235 predicted 990
10 SASI_Rn02_00363236 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375555 predicted 746
2 SASI_Rn02_00375556 predicted 681
3 SASI_Rn02_00375557 predicted 947
4 SASI_Rn02_00375558 predicted 684
5 SASI_Rn02_00375559 predicted 987
6 SASI_Rn02_00375560 predicted 1147
7 SASI_Rn02_00375561 predicted 1120
8 SASI_Rn02_00375562 predicted 1435
9 SASI_Rn02_00375563 predicted 1143
10 SASI_Rn02_00375564 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167026 predicted 1205
2 SASI_Mm02_00321541 predicted 819
3 SASI_Mm02_00321542 predicted 1070
4 SASI_Mm01_00167030 predicted 510
5 SASI_Mm01_00167031 predicted 366
6 SASI_Mm01_00167033 predicted 659
7 SASI_Mm01_00167034 predicted 747
8 SASI_Mm02_00321543 predicted 479
9 SASI_Mm01_00167035 predicted 1082
10 SASI_Mm02_00321544 predicted 695
11 SASI_Mm01_00167027 predicted 963
12 SASI_Mm01_00167028 predicted 500
13 SASI_Mm01_00167029 predicted 752
14 SASI_Mm01_00167032 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012262
VALIDATED
HS2ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 2-O-sulfotransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-509s1c1
Sequence:CCGGCGAGAAATTGAGCAGCGACATCTCGAGATGTCGCTGCTCAATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-671s1c1
Sequence:CCGGCTTCATATCAACACTACCAAACTCGAGTTTGGTAGTGTTGATATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-780s1c1
Sequence:CCGGGACACGTTTCTTACTTGGATTCTCGAGAATCCAAGTAAGAAACGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-1245s1c1
Sequence:CCGGCCACTAAACAAACCATTGCAACTCGAGTTGCAATGGTTTGTTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-1064s1c1
Sequence:CCGGGCTATGGATCAAGCCAAGTATCTCGAGATACTTGGCTTGATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012262.3-1816s21c1
Sequence:CCGGGAATTAAGATGAGTCCATTTGCTCGAGCAAATGGACTCATCTTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-867s21c1
Sequence:CCGGATGTCATAAGGGATCCTATTGCTCGAGCAATAGGATCCCTTATGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-1443s21c1
Sequence:CCGGCTAAGTCGAACTGAGTATAAGCTCGAGCTTATACTCAGTTCGACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012262
VALIDATED
HS2ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 2-O-sulfotransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-509s1c1
Sequence:CCGGCGAGAAATTGAGCAGCGACATCTCGAGATGTCGCTGCTCAATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-671s1c1
Sequence:CCGGCTTCATATCAACACTACCAAACTCGAGTTTGGTAGTGTTGATATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-780s1c1
Sequence:CCGGGACACGTTTCTTACTTGGATTCTCGAGAATCCAAGTAAGAAACGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-1245s1c1
Sequence:CCGGCCACTAAACAAACCATTGCAACTCGAGTTGCAATGGTTTGTTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-1064s1c1
Sequence:CCGGGCTATGGATCAAGCCAAGTATCTCGAGATACTTGGCTTGATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012262.3-1816s21c1
Sequence:CCGGGAATTAAGATGAGTCCATTTGCTCGAGCAAATGGACTCATCTTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-867s21c1
Sequence:CCGGATGTCATAAGGGATCCTATTGCTCGAGCAATAGGATCCCTTATGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-1443s21c1
Sequence:CCGGCTAAGTCGAACTGAGTATAAGCTCGAGCTTATACTCAGTTCGACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012262
VALIDATED
HS2ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 2-O-sulfotransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-509s1c1
Sequence:CCGGCGAGAAATTGAGCAGCGACATCTCGAGATGTCGCTGCTCAATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-671s1c1
Sequence:CCGGCTTCATATCAACACTACCAAACTCGAGTTTGGTAGTGTTGATATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-780s1c1
Sequence:CCGGGACACGTTTCTTACTTGGATTCTCGAGAATCCAAGTAAGAAACGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012262.2-1245s1c1
Sequence:CCGGCCACTAAACAAACCATTGCAACTCGAGTTGCAATGGTTTGTTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012262.2-1064s1c1
Sequence:CCGGGCTATGGATCAAGCCAAGTATCTCGAGATACTTGGCTTGATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012262.3-1816s21c1
Sequence:CCGGGAATTAAGATGAGTCCATTTGCTCGAGCAAATGGACTCATCTTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-867s21c1
Sequence:CCGGATGTCATAAGGGATCCTATTGCTCGAGCAATAGGATCCCTTATGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012262.3-1443s21c1
Sequence:CCGGCTAAGTCGAACTGAGTATAAGCTCGAGCTTATACTCAGTTCGACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011828
VALIDATED
HS2ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 2-O-sulfotransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011828.2-1880s1c1
Sequence:CCGGGCCCATATTTATGTAGGCTTTCTCGAGAAAGCCTACATAAATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1202s1c1
Sequence:CCGGGCAGTCTGACATTTGGAAGATCTCGAGATCTTCCAAATGTCAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1005s1c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-851s1c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-794s1c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-923s21c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-866s21c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-816s21c1
Sequence:CCGGGTGAAGAAGAAACCAATTTATCTCGAGATAAATTGGTTTCTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011828.3-1717s21c1
Sequence:CCGGTCAGATGGCTGAATACCATTTCTCGAGAAATGGTATTCAGCCATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-1077s21c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011828
VALIDATED
HS2ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 2-O-sulfotransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011828.2-1880s1c1
Sequence:CCGGGCCCATATTTATGTAGGCTTTCTCGAGAAAGCCTACATAAATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1202s1c1
Sequence:CCGGGCAGTCTGACATTTGGAAGATCTCGAGATCTTCCAAATGTCAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1005s1c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-851s1c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-794s1c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-923s21c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-866s21c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-816s21c1
Sequence:CCGGGTGAAGAAGAAACCAATTTATCTCGAGATAAATTGGTTTCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011828.3-1717s21c1
Sequence:CCGGTCAGATGGCTGAATACCATTTCTCGAGAAATGGTATTCAGCCATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-1077s21c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011828
VALIDATED
HS2ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 2-O-sulfotransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011828.2-1880s1c1
Sequence:CCGGGCCCATATTTATGTAGGCTTTCTCGAGAAAGCCTACATAAATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1202s1c1
Sequence:CCGGGCAGTCTGACATTTGGAAGATCTCGAGATCTTCCAAATGTCAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-1005s1c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-851s1c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011828.2-794s1c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-923s21c1
Sequence:CCGGGAGACGGAAACAAGGAGACAACTCGAGTTGTCTCCTTGTTTCCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-866s21c1
Sequence:CCGGGCTAGTTTCCTACTATTACTTCTCGAGAAGTAATAGTAGGAAACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-816s21c1
Sequence:CCGGGTGAAGAAGAAACCAATTTATCTCGAGATAAATTGGTTTCTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011828.3-1717s21c1
Sequence:CCGGTCAGATGGCTGAATACCATTTCTCGAGAAATGGTATTCAGCCATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011828.3-1077s21c1
Sequence:CCGGGCTAAGTCTAACCTCATTAATCTCGAGATTAATGAGGTTAGACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)