EMAIL THIS PAGE TO A FRIEND

HS3ST1

heparan sulfate (glucosamine) 3-O-sulfotransferase 1

90 Gene Product Result for
Synonyms: 3OST 3OST1
UniProtKB ID: O14792, B3KUA6, Q6PEY8
Gene ID:
Human(9957) Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It possesses both heparan sulfate glucosaminyl 3-O-sulfotransferase activity, anticoagulant heparan sulfate conversion activity, and is a rate limiting enzyme for synthesis of anticoagulant heparan. This enzyme is an intraluminal Golgi resident protein. [provided by RefSeq, Jul 2008]
Mouse(15476) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Rat(84406) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Zebrafish(565201) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
dog(403672) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
cow(538691) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
domestic cat(101090103) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
chicken(422840) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
sheep(101104909) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
domestic guinea pig(100728866) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
naked mole-rat(101698728) heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028431 MISSION® esiRNA esiRNA targeting mouse Hs3st1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005114 Rosetta Predictions human pricing
NM_053391 Rosetta Predictions rat pricing
NM_010474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053458 predicted 1202
2 SASI_Hs01_00053459 predicted 1046
3 SASI_Hs01_00053461 predicted 686
4 SASI_Hs01_00053462 predicted 1045
5 SASI_Hs01_00053463 predicted 778
6 SASI_Hs02_00339006 predicted 1207
7 SASI_Hs01_00053464 predicted 1737
8 SASI_Hs01_00053465 predicted 1236
9 SASI_Hs01_00053466 predicted 1243
10 SASI_Hs01_00053467 predicted 1145
11 SASI_Hs01_00053460 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031093 predicted 374
2 SASI_Rn01_00031094 predicted 460
3 SASI_Rn01_00031095 predicted 559
4 SASI_Rn01_00031096 predicted 687
5 SASI_Rn02_00265889 predicted 637
6 SASI_Rn01_00031097 predicted 472
7 SASI_Rn01_00031098 predicted 704
8 SASI_Rn01_00031099 predicted 400
9 SASI_Rn01_00031101 predicted 510
10 SASI_Rn01_00031102 predicted 646
11 SASI_Rn01_00031100 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190219 predicted 871
2 SASI_Mm01_00190220 predicted 840
3 SASI_Mm01_00190221 predicted 900
4 SASI_Mm01_00190222 predicted 1087
5 SASI_Mm01_00190223 predicted 694
6 SASI_Mm01_00190224 predicted 788
7 SASI_Mm01_00190225 predicted 1182
8 SASI_Mm01_00190226 predicted 848
9 SASI_Mm01_00190227 predicted 723
10 SASI_Mm01_00190228 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005114
VALIDATED
HS3ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1485s21c1
Sequence:GTACCGGATGAAGGAACTAAACTATTTCCTCGAGGAAATAGTTTAGTTCCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1237s21c1
Sequence:GTACCGGACTGGCACTGATTTGCAATAACTCGAGTTATTGCAAATCAGTGCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-870s21c1
Sequence:GTACCGGAGGCTCAATGTGGACTACAAGCTCGAGCTTGTAGTCCACATTGAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-797s21c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1048s21c1
Sequence:CCGGATGCTTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1381s21c1
Sequence:CCGGGATTCACAATTGCCATATATACTCGAGTATATATGGCAATTGTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1154s21c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-591s21c1
Sequence:CCGGTTCGACTGGGAGGAGCATTACCTCGAGGTAATGCTCCTCCCAGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-688s21c1
Sequence:GTACCGGCGTATTTCACGTCGCCCAAAGCTCGAGCTTTGGGCGACGTGAAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1215s21c1
Sequence:GTACCGGGAGCTTGTTGGCAGAACATTTCTCGAGAAATGTTCTGCCAACAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-775s21c1
Sequence:GTACCGGAGCGCGTGCTATCTGACTACACTCGAGTGTAGTCAGATAGCACGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-1071s1c1
Sequence:CCGGCCTACTGTAAGTTCTGGTGTACTCGAGTACACCAGAACTTACAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005114.1-908s1c1
Sequence:CCGGCGCTGCTTACATGAGTCCAAACTCGAGTTTGGACTCATGTAAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-949s1c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-592s1c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005114
VALIDATED
HS3ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1485s21c1
Sequence:GTACCGGATGAAGGAACTAAACTATTTCCTCGAGGAAATAGTTTAGTTCCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1237s21c1
Sequence:GTACCGGACTGGCACTGATTTGCAATAACTCGAGTTATTGCAAATCAGTGCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-870s21c1
Sequence:GTACCGGAGGCTCAATGTGGACTACAAGCTCGAGCTTGTAGTCCACATTGAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-797s21c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1048s21c1
Sequence:CCGGATGCTTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1381s21c1
Sequence:CCGGGATTCACAATTGCCATATATACTCGAGTATATATGGCAATTGTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1154s21c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-591s21c1
Sequence:CCGGTTCGACTGGGAGGAGCATTACCTCGAGGTAATGCTCCTCCCAGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-688s21c1
Sequence:GTACCGGCGTATTTCACGTCGCCCAAAGCTCGAGCTTTGGGCGACGTGAAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1215s21c1
Sequence:GTACCGGGAGCTTGTTGGCAGAACATTTCTCGAGAAATGTTCTGCCAACAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-775s21c1
Sequence:GTACCGGAGCGCGTGCTATCTGACTACACTCGAGTGTAGTCAGATAGCACGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-1071s1c1
Sequence:CCGGCCTACTGTAAGTTCTGGTGTACTCGAGTACACCAGAACTTACAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005114.1-908s1c1
Sequence:CCGGCGCTGCTTACATGAGTCCAAACTCGAGTTTGGACTCATGTAAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-949s1c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-592s1c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005114
VALIDATED
HS3ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1485s21c1
Sequence:GTACCGGATGAAGGAACTAAACTATTTCCTCGAGGAAATAGTTTAGTTCCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1237s21c1
Sequence:GTACCGGACTGGCACTGATTTGCAATAACTCGAGTTATTGCAAATCAGTGCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-870s21c1
Sequence:GTACCGGAGGCTCAATGTGGACTACAAGCTCGAGCTTGTAGTCCACATTGAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-797s21c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1048s21c1
Sequence:CCGGATGCTTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005114.2-1381s21c1
Sequence:CCGGGATTCACAATTGCCATATATACTCGAGTATATATGGCAATTGTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1154s21c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-591s21c1
Sequence:CCGGTTCGACTGGGAGGAGCATTACCTCGAGGTAATGCTCCTCCCAGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-688s21c1
Sequence:GTACCGGCGTATTTCACGTCGCCCAAAGCTCGAGCTTTGGGCGACGTGAAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-1215s21c1
Sequence:GTACCGGGAGCTTGTTGGCAGAACATTTCTCGAGAAATGTTCTGCCAACAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005114.2-775s21c1
Sequence:GTACCGGAGCGCGTGCTATCTGACTACACTCGAGTGTAGTCAGATAGCACGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-1071s1c1
Sequence:CCGGCCTACTGTAAGTTCTGGTGTACTCGAGTACACCAGAACTTACAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005114.1-908s1c1
Sequence:CCGGCGCTGCTTACATGAGTCCAAACTCGAGTTTGGACTCATGTAAGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-949s1c1
Sequence:CCGGCGATCCCAAACTACTCAATAACTCGAGTTATTGAGTAGTTTGGGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005114.1-592s1c1
Sequence:CCGGCCAAGTGTTCTACAACCACATCTCGAGATGTGGTTGTAGAACACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010474
VALIDATED
HS3ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-684s21c1
Sequence:GTACCGGGGAGAAGACACCCGCCTATTTCTCGAGAAATAGGCGGGTGTCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1058s21c1
Sequence:GTACCGGACGCCTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1240s21c1
Sequence:GTACCGGACATTCGACTGGCACTGATTTCTCGAGAAATCAGTGCCAGTCGAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010474.2-1397s21c1
Sequence:GTACCGGGATTCACAGTTGCCATATATACTCGAGTATATATGGCAACTGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010474.2-419s21c1
Sequence:GTACCGGAGCTTCTGAGGAAGGTGATTACTCGAGTAATCACCTTCCTCAGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-849s21c1
Sequence:GTACCGGACCCATTGAGGACCTCCTAATCTCGAGATTAGGAGGTCCTCAATGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1510s1c1
Sequence:CCGGGAACTTAACTATTGCACTGAACTCGAGTTCAGTGCAATAGTTAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1192s1c1
Sequence:CCGGCGAATACTTTCATGAGCCAAACTCGAGTTTGGCTCATGAAAGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1060s1c1
Sequence:CCGGCGCCTCGAACTTCTACTTTAACTCGAGTTAAAGTAGAAGTTCGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1124s1c1
Sequence:CCGGCGCTGCTTACACGAGTCCAAACTCGAGTTTGGACTCGTGTAAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-698s1c1
Sequence:CCGGGCCTATTTCACTTCGCCCAAACTCGAGTTTGGGCGAAGTGAAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010474
VALIDATED
HS3ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-684s21c1
Sequence:GTACCGGGGAGAAGACACCCGCCTATTTCTCGAGAAATAGGCGGGTGTCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1058s21c1
Sequence:GTACCGGACGCCTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1240s21c1
Sequence:GTACCGGACATTCGACTGGCACTGATTTCTCGAGAAATCAGTGCCAGTCGAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010474.2-1397s21c1
Sequence:GTACCGGGATTCACAGTTGCCATATATACTCGAGTATATATGGCAACTGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010474.2-419s21c1
Sequence:GTACCGGAGCTTCTGAGGAAGGTGATTACTCGAGTAATCACCTTCCTCAGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-849s21c1
Sequence:GTACCGGACCCATTGAGGACCTCCTAATCTCGAGATTAGGAGGTCCTCAATGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1510s1c1
Sequence:CCGGGAACTTAACTATTGCACTGAACTCGAGTTCAGTGCAATAGTTAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1192s1c1
Sequence:CCGGCGAATACTTTCATGAGCCAAACTCGAGTTTGGCTCATGAAAGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1060s1c1
Sequence:CCGGCGCCTCGAACTTCTACTTTAACTCGAGTTAAAGTAGAAGTTCGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1124s1c1
Sequence:CCGGCGCTGCTTACACGAGTCCAAACTCGAGTTTGGACTCGTGTAAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-698s1c1
Sequence:CCGGGCCTATTTCACTTCGCCCAAACTCGAGTTTGGGCGAAGTGAAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010474
VALIDATED
HS3ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-684s21c1
Sequence:GTACCGGGGAGAAGACACCCGCCTATTTCTCGAGAAATAGGCGGGTGTCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1058s21c1
Sequence:GTACCGGACGCCTCGAACTTCTACTTTACTCGAGTAAAGTAGAAGTTCGAGGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-1240s21c1
Sequence:GTACCGGACATTCGACTGGCACTGATTTCTCGAGAAATCAGTGCCAGTCGAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010474.2-1397s21c1
Sequence:GTACCGGGATTCACAGTTGCCATATATACTCGAGTATATATGGCAACTGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010474.2-419s21c1
Sequence:GTACCGGAGCTTCTGAGGAAGGTGATTACTCGAGTAATCACCTTCCTCAGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010474.2-849s21c1
Sequence:GTACCGGACCCATTGAGGACCTCCTAATCTCGAGATTAGGAGGTCCTCAATGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1510s1c1
Sequence:CCGGGAACTTAACTATTGCACTGAACTCGAGTTCAGTGCAATAGTTAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1192s1c1
Sequence:CCGGCGAATACTTTCATGAGCCAAACTCGAGTTTGGCTCATGAAAGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-1060s1c1
Sequence:CCGGCGCCTCGAACTTCTACTTTAACTCGAGTTAAAGTAGAAGTTCGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010474.1-1124s1c1
Sequence:CCGGCGCTGCTTACACGAGTCCAAACTCGAGTTTGGACTCGTGTAAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010474.1-698s1c1
Sequence:CCGGGCCTATTTCACTTCGCCCAAACTCGAGTTTGGGCGAAGTGAAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)