EMAIL THIS PAGE TO A FRIEND

HS3ST2

heparan sulfate (glucosamine) 3-O-sulfotransferase 2

164 Gene Product Result for
Synonyms: 30ST2 3OST2
UniProtKB ID: Q9Y278, Q52LZ1
Gene ID:
Human(9956) Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. This gene is expressed predominantly in brain and may play a role in the nervous system. [provided by RefSeq, Jul 2008]
Mouse(195646) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Rat(293451) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Zebrafish(571246) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
chicken(416581) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
domestic cat(101090732) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
cow(532099) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Horse(100068342) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
dog(489975) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
domestic guinea pig(100720379) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
naked mole-rat(101715838) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
sheep(101116370) heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019951 MISSION® esiRNA esiRNA human HS3ST2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006043 Rosetta Predictions human pricing
NM_181370 Rosetta Predictions rat pricing
NM_001081327 Rosetta Predictions mouse pricing
XM_112440 Rosetta Predictions mouse pricing
XM_894488 Rosetta Predictions mouse pricing
XM_901598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340789 predicted 1469
2 SASI_Hs02_00340790 predicted 948
3 SASI_Hs02_00340791 predicted 1040
4 SASI_Hs02_00340792 predicted 1063
5 SASI_Hs01_00186105 predicted 1468
6 SASI_Hs01_00186106 predicted 1401
7 SASI_Hs02_00340793 predicted 1468
8 SASI_Hs02_00340794 predicted 1077
9 SASI_Hs01_00186108 predicted 1243
10 SASI_Hs02_00340795 predicted 1093
11 SASI_Hs01_00186107 predicted 1403
12 SASI_Hs01_00186109 predicted 1215
13 SASI_Hs01_00186110 predicted 1249
14 SASI_Hs01_00186111 predicted 1376
15 SASI_Hs01_00186112 predicted 1374
16 SASI_Hs01_00186113 predicted 1216
17 SASI_Hs01_00186114 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110843 predicted 974
2 SASI_Rn01_00110844 predicted 790
3 SASI_Rn01_00110845 predicted 1693
4 SASI_Rn01_00110846 predicted 784
5 SASI_Rn01_00110848 predicted 1690
6 SASI_Rn01_00110849 predicted 1682
7 SASI_Rn01_00110850 predicted 1680
8 SASI_Rn02_00269700 predicted 1625
9 SASI_Rn01_00110852 predicted 973
10 SASI_Rn02_00269701 predicted 1429
11 SASI_Rn01_00110847 predicted 1340
12 SASI_Rn01_00110851 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297331 predicted 781
2 SASI_Mm02_00297332 predicted 971
3 SASI_Mm02_00297333 predicted 1839
4 SASI_Mm02_00297334 predicted 961
5 SASI_Mm02_00297335 predicted 1428
6 SASI_Mm02_00297336 predicted 1071
7 SASI_Mm02_00297337 predicted 1085
8 SASI_Mm02_00297338 predicted 1543
9 SASI_Mm02_00297339 predicted 1786
10 SASI_Mm02_00297340 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_112440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282807 predicted 1215
2 SASI_Mm01_00282808 predicted 712
3 SASI_Mm01_00282809 predicted 1194
4 SASI_Mm01_00282810 predicted 1143
5 SASI_Mm01_00282811 predicted 1056
6 SASI_Mm01_00282812 predicted 739
7 SASI_Mm01_00282813 predicted 989
8 SASI_Mm01_00282814 predicted 1194
9 SASI_Mm01_00282815 predicted 1184
10 SASI_Mm01_00282816 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246051 predicted 791
2 SASI_Mm01_00246052 predicted 1837
3 SASI_Mm01_00246053 predicted 1824
4 SASI_Mm01_00246054 predicted 967
5 SASI_Mm01_00246055 predicted 1427
6 SASI_Mm01_00246056 predicted 1076
7 SASI_Mm01_00246057 predicted 1089
8 SASI_Mm01_00246058 predicted 1552
9 SASI_Mm01_00246059 predicted 1799
10 SASI_Mm01_00246060 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275091 predicted 1243
2 SASI_Mm01_00275092 predicted 1044
3 SASI_Mm01_00275093 predicted 1062
4 SASI_Mm01_00275094 predicted 813
5 SASI_Mm01_00275095 predicted 1163
6 SASI_Mm01_00275096 predicted 1132
7 SASI_Mm01_00275097 predicted 866
8 SASI_Mm01_00275098 predicted 1183
9 SASI_Mm01_00275099 predicted 901
10 SASI_Mm01_00275100 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006043
HS3ST2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-945s1c1
Sequence:CCGGCCTGGGCATTAAGAGATTCATCTCGAGATGAATCTCTTAATGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-871s1c1
Sequence:CCGGGCTCAGATTCACTTCGTCAGTCTCGAGACTGACGAAGTGAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-147s1c1
Sequence:CCGGGCTCTCGCTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAGCGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-460s1c1
Sequence:CCGGGTGCTGGAGTTTATCCGAGTACTCGAGTACTCGGATAAACTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-989s1c1
Sequence:CCGGACAAGACCAAAGGATTCCCTTCTCGAGAAGGGAATCCTTTGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1394s21c1
Sequence:CCGGCTCCTGGCACGTCCAGTAAATCTCGAGATTTACTGGACGTGCCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1477s21c1
Sequence:CCGGTGTTCCAATGATGATAGATATCTCGAGATATCTATCATCATTGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006043.1-697s21c1
Sequence:CCGGACCCGTGCCATCTCTGATTACCTCGAGGTAATCAGAGATGGCACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006043
HS3ST2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-945s1c1
Sequence:CCGGCCTGGGCATTAAGAGATTCATCTCGAGATGAATCTCTTAATGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-871s1c1
Sequence:CCGGGCTCAGATTCACTTCGTCAGTCTCGAGACTGACGAAGTGAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-147s1c1
Sequence:CCGGGCTCTCGCTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAGCGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-460s1c1
Sequence:CCGGGTGCTGGAGTTTATCCGAGTACTCGAGTACTCGGATAAACTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-989s1c1
Sequence:CCGGACAAGACCAAAGGATTCCCTTCTCGAGAAGGGAATCCTTTGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1394s21c1
Sequence:CCGGCTCCTGGCACGTCCAGTAAATCTCGAGATTTACTGGACGTGCCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1477s21c1
Sequence:CCGGTGTTCCAATGATGATAGATATCTCGAGATATCTATCATCATTGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006043.1-697s21c1
Sequence:CCGGACCCGTGCCATCTCTGATTACCTCGAGGTAATCAGAGATGGCACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006043
HS3ST2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-945s1c1
Sequence:CCGGCCTGGGCATTAAGAGATTCATCTCGAGATGAATCTCTTAATGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-871s1c1
Sequence:CCGGGCTCAGATTCACTTCGTCAGTCTCGAGACTGACGAAGTGAATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-147s1c1
Sequence:CCGGGCTCTCGCTCTCCTGCACTTACTCGAGTAAGTGCAGGAGAGCGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-460s1c1
Sequence:CCGGGTGCTGGAGTTTATCCGAGTACTCGAGTACTCGGATAAACTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006043.1-989s1c1
Sequence:CCGGACAAGACCAAAGGATTCCCTTCTCGAGAAGGGAATCCTTTGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1394s21c1
Sequence:CCGGCTCCTGGCACGTCCAGTAAATCTCGAGATTTACTGGACGTGCCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006043.1-1477s21c1
Sequence:CCGGTGTTCCAATGATGATAGATATCTCGAGATATCTATCATCATTGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006043.1-697s21c1
Sequence:CCGGACCCGTGCCATCTCTGATTACCTCGAGGTAATCAGAGATGGCACGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081327
HS3ST2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1073s21c1
Sequence:CCGGTGACTACACGCAGACTCTTTCCTCGAGGAAAGAGTCTGCGTGTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1440s21c1
Sequence:CCGGCAGATCGACCCTGAAGTTATACTCGAGTATAACTTCAGGGTCGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1174s21c1
Sequence:CCGGCTATCCGCATTGGCATGTATGCTCGAGCATACATGCCAATGCGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081327.1-1876s21c1
Sequence:CCGGACACTCAGTGGTGGGCGTAATCTCGAGATTACGCCCACCACTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1279s21c1
Sequence:CCGGCTGGTGAGATGGGTCGTATTCCTCGAGGAATACGACCCATCTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081327
HS3ST2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1073s21c1
Sequence:CCGGTGACTACACGCAGACTCTTTCCTCGAGGAAAGAGTCTGCGTGTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1440s21c1
Sequence:CCGGCAGATCGACCCTGAAGTTATACTCGAGTATAACTTCAGGGTCGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1174s21c1
Sequence:CCGGCTATCCGCATTGGCATGTATGCTCGAGCATACATGCCAATGCGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081327.1-1876s21c1
Sequence:CCGGACACTCAGTGGTGGGCGTAATCTCGAGATTACGCCCACCACTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1279s21c1
Sequence:CCGGCTGGTGAGATGGGTCGTATTCCTCGAGGAATACGACCCATCTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081327
HS3ST2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1073s21c1
Sequence:CCGGTGACTACACGCAGACTCTTTCCTCGAGGAAAGAGTCTGCGTGTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1440s21c1
Sequence:CCGGCAGATCGACCCTGAAGTTATACTCGAGTATAACTTCAGGGTCGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1174s21c1
Sequence:CCGGCTATCCGCATTGGCATGTATGCTCGAGCATACATGCCAATGCGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081327.1-1876s21c1
Sequence:CCGGACACTCAGTGGTGGGCGTAATCTCGAGATTACGCCCACCACTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081327.1-1279s21c1
Sequence:CCGGCTGGTGAGATGGGTCGTATTCCTCGAGGAATACGACCCATCTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)