EMAIL THIS PAGE TO A FRIEND

HS3ST3B1

heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1

79 Gene Product Result for
Synonyms: 30ST3B1 3OST3B1
UniProtKB ID: Q9Y662, B3KN58, D3DTS6
Gene ID:
Human(9953) Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. The sulfotransferase domain of this enzyme is highly similar to the same domain of heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3A1, and these two enzymes sulfate an identical disaccharide. This gene is widely expressed, with the most abundant expression in liver and placenta. [provided by RefSeq, Jul 2008]
Mouse(54710) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Rat(303218) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Horse(100063069) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
dog(489516) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
cow(617069) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
domestic guinea pig(100724084) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
naked mole-rat(101696746) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
sheep(101115554) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Domestic Rabbit(100352865) heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113761 MISSION® esiRNA esiRNA human HS3ST3B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006041 Rosetta Predictions human pricing
XM_001078394 Rosetta Predictions rat pricing
XM_220557 Rosetta Predictions rat pricing
NM_018805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166697 predicted 1071
2 SASI_Hs01_00166698 predicted 964
3 SASI_Hs01_00166699 predicted 1071
4 SASI_Hs01_00166700 predicted 1807
5 SASI_Hs01_00166701 predicted 1047
6 SASI_Hs01_00166702 predicted 1129
7 SASI_Hs01_00166704 predicted 868
8 SASI_Hs01_00166705 predicted 1029
9 SASI_Hs01_00166706 predicted 972
10 SASI_Hs02_00340787 predicted 868
11 SASI_Hs01_00166703 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360624 predicted 811
2 SASI_Rn02_00360625 predicted 1033
3 SASI_Rn02_00360626 predicted 685
4 SASI_Rn02_00360627 predicted 807
5 SASI_Rn02_00360628 predicted 1151
6 SASI_Rn02_00360629 predicted 760
7 SASI_Rn02_00360630 predicted 1243
8 SASI_Rn02_00360631 predicted 1114
9 SASI_Rn02_00360632 predicted 1144
10 SASI_Rn02_00360633 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379391 predicted 811
2 SASI_Rn02_00379392 predicted 1030
3 SASI_Rn02_00379393 predicted 682
4 SASI_Rn02_00379394 predicted 812
5 SASI_Rn02_00379395 predicted 1154
6 SASI_Rn02_00379396 predicted 763
7 SASI_Rn02_00379397 predicted 1245
8 SASI_Rn02_00379398 predicted 1118
9 SASI_Rn02_00379399 predicted 1142
10 SASI_Rn02_00379400 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022456 predicted 1723
2 SASI_Mm01_00022457 predicted 1851
3 SASI_Mm01_00022458 predicted 1683
4 SASI_Mm01_00022459 predicted 1698
5 SASI_Mm01_00022460 predicted 1580
6 SASI_Mm01_00022462 predicted 1701
7 SASI_Mm01_00022464 predicted 1658
8 SASI_Mm01_00022465 predicted 1724
9 SASI_Mm02_00324144 predicted 1715
10 SASI_Mm02_00324145 predicted 1659
11 SASI_Mm01_00022461 predicted 934
12 SASI_Mm01_00022463 predicted 1911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018805
HS3ST3B1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000098345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-653s1c1
Sequence:CCGGGCAGGCAAGGATAAGACAGTACTCGAGTACTGTCTTATCCTTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-560s1c1
Sequence:CCGGCGCGCTACTCACGCTCAGCCACTCGAGTGGCTGAGCGTGAGTAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-469s1c1
Sequence:CCGGCATGCTTTGCATCTGGCTGTACTCGAGTACAGCCAGATGCAAAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-1108s1c1
Sequence:CCGGCGAGAGCCTGACGTTCCGCAACTCGAGTTGCGGAACGTCAGGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018805
HS3ST3B1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000098345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-653s1c1
Sequence:CCGGGCAGGCAAGGATAAGACAGTACTCGAGTACTGTCTTATCCTTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-560s1c1
Sequence:CCGGCGCGCTACTCACGCTCAGCCACTCGAGTGGCTGAGCGTGAGTAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-469s1c1
Sequence:CCGGCATGCTTTGCATCTGGCTGTACTCGAGTACAGCCAGATGCAAAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-1108s1c1
Sequence:CCGGCGAGAGCCTGACGTTCCGCAACTCGAGTTGCGGAACGTCAGGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018805
HS3ST3B1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000098345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-653s1c1
Sequence:CCGGGCAGGCAAGGATAAGACAGTACTCGAGTACTGTCTTATCCTTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-560s1c1
Sequence:CCGGCGCGCTACTCACGCTCAGCCACTCGAGTGGCTGAGCGTGAGTAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-469s1c1
Sequence:CCGGCATGCTTTGCATCTGGCTGTACTCGAGTACAGCCAGATGCAAAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018805.1-1108s1c1
Sequence:CCGGCGAGAGCCTGACGTTCCGCAACTCGAGTTGCGGAACGTCAGGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006041
HS3ST3B1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-456s1c1
Sequence:CCGGCTGGCTCTATATGTTCCTGTACTCGAGTACAGGAACATATAGAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1281s1c1
Sequence:CCGGCAAGAGGATCATCACGGACAACTCGAGTTGTCCGTGATGATCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1299s1c1
Sequence:CCGGCAAGCACTTCTACTTCAACAACTCGAGTTGTTGAAGTAGAAGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-447s1c1
Sequence:CCGGGCTCTGCGTCTGGCTCTATATCTCGAGATATAGAGCCAGACGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1449s1c1
Sequence:CCGGGCCTTTCAACCTCAAGTTCTACTCGAGTAGAACTTGAGGTTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1526s21c1
Sequence:CCGGACCCACGTGGCTTATCTATTGCTCGAGCAATAGATAAGCCACGTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1683s21c1
Sequence:CCGGAGTGTTTAACTCTAGTATTTCCTCGAGGAAATACTAGAGTTAAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006041.1-841s21c1
Sequence:CCGGCATTTCTTCGATCGCAGCTACCTCGAGGTAGCTGCGATCGAAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006041
HS3ST3B1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-456s1c1
Sequence:CCGGCTGGCTCTATATGTTCCTGTACTCGAGTACAGGAACATATAGAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1281s1c1
Sequence:CCGGCAAGAGGATCATCACGGACAACTCGAGTTGTCCGTGATGATCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1299s1c1
Sequence:CCGGCAAGCACTTCTACTTCAACAACTCGAGTTGTTGAAGTAGAAGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-447s1c1
Sequence:CCGGGCTCTGCGTCTGGCTCTATATCTCGAGATATAGAGCCAGACGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1449s1c1
Sequence:CCGGGCCTTTCAACCTCAAGTTCTACTCGAGTAGAACTTGAGGTTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1526s21c1
Sequence:CCGGACCCACGTGGCTTATCTATTGCTCGAGCAATAGATAAGCCACGTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1683s21c1
Sequence:CCGGAGTGTTTAACTCTAGTATTTCCTCGAGGAAATACTAGAGTTAAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006041.1-841s21c1
Sequence:CCGGCATTTCTTCGATCGCAGCTACCTCGAGGTAGCTGCGATCGAAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006041
HS3ST3B1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-456s1c1
Sequence:CCGGCTGGCTCTATATGTTCCTGTACTCGAGTACAGGAACATATAGAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1281s1c1
Sequence:CCGGCAAGAGGATCATCACGGACAACTCGAGTTGTCCGTGATGATCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1299s1c1
Sequence:CCGGCAAGCACTTCTACTTCAACAACTCGAGTTGTTGAAGTAGAAGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-447s1c1
Sequence:CCGGGCTCTGCGTCTGGCTCTATATCTCGAGATATAGAGCCAGACGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006041.1-1449s1c1
Sequence:CCGGGCCTTTCAACCTCAAGTTCTACTCGAGTAGAACTTGAGGTTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1526s21c1
Sequence:CCGGACCCACGTGGCTTATCTATTGCTCGAGCAATAGATAAGCCACGTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006041.1-1683s21c1
Sequence:CCGGAGTGTTTAACTCTAGTATTTCCTCGAGGAAATACTAGAGTTAAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006041.1-841s21c1
Sequence:CCGGCATTTCTTCGATCGCAGCTACCTCGAGGTAGCTGCGATCGAAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)