EMAIL THIS PAGE TO A FRIEND

HS3ST5

heparan sulfate (glucosamine) 3-O-sulfotransferase 5

174 Gene Product Result for
Synonyms: 3-OST-5 3OST5 HS3OST5 NBLA04021
UniProtKB ID: Q8IZT8, A8K1J2, Q52LI2, Q8N285
Gene ID:
Human(222537) Summary: HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]
Mouse(319415) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Rat(294449) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
domestic guinea pig(100715395) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
naked mole-rat(101710328) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
sheep(101107448) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
chicken(428621) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
dog(481968) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
cow(540355) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
domestic cat(101088412) heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153612 Rosetta Predictions human pricing
NM_001106392 Rosetta Predictions rat pricing
XM_228219 Rosetta Predictions rat pricing
NM_001081208 Rosetta Predictions mouse pricing
XM_356462 Rosetta Predictions mouse pricing
XM_890691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014153 predicted 711
2 SASI_Hs01_00014154 predicted 356
3 SASI_Hs01_00014155 predicted 553
4 SASI_Hs02_00367351 predicted 709
5 SASI_Hs02_00367352 predicted 997
6 SASI_Hs01_00014160 predicted 717
7 SASI_Hs01_00014161 predicted 770
8 SASI_Hs02_00367353 predicted 379
9 SASI_Hs02_00367354 predicted 743
10 SASI_Hs02_00367355 predicted 672
11 SASI_Hs01_00014156 predicted 309
12 SASI_Hs01_00014157 predicted 548
13 SASI_Hs01_00014158 predicted 688
14 SASI_Hs01_00014159 predicted 726
15 SASI_Hs01_00014162 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218508 predicted 1980
2 SASI_Rn02_00218509 predicted 2038
3 SASI_Rn02_00218510 predicted 1600
4 SASI_Rn02_00218511 predicted 1835
5 SASI_Rn02_00218512 predicted 2113
6 SASI_Rn02_00218513 predicted 2128
7 SASI_Rn02_00218514 predicted 1802
8 SASI_Rn02_00218515 predicted 1996
9 SASI_Rn02_00218516 predicted 1158
10 SASI_Rn02_00218517 predicted 2206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167539 predicted 467
2 SASI_Rn01_00167540 predicted 367
3 SASI_Rn01_00167541 predicted 358
4 SASI_Rn01_00167542 predicted 440
5 SASI_Rn01_00167543 predicted 309
6 SASI_Rn01_00167544 predicted 678
7 SASI_Rn01_00167545 predicted 358
8 SASI_Rn01_00167546 predicted 646
9 SASI_Rn01_00167547 predicted 310
10 SASI_Rn01_00167548 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296241 predicted 1742
2 SASI_Mm02_00296242 predicted 1832
3 SASI_Mm02_00296243 predicted 1778
4 SASI_Mm02_00296244 predicted 1979
5 SASI_Mm02_00296245 predicted 1959
6 SASI_Mm02_00296246 predicted 1663
7 SASI_Mm02_00296247 predicted 1835
8 SASI_Mm02_00296248 predicted 2012
9 SASI_Mm02_00296249 predicted 1647
10 SASI_Mm02_00296250 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275435 predicted 1747
2 SASI_Mm01_00275436 predicted 1834
3 SASI_Mm01_00275437 predicted 1780
4 SASI_Mm01_00275438 predicted 1982
5 SASI_Mm01_00275439 predicted 1961
6 SASI_Mm01_00275440 predicted 1669
7 SASI_Mm01_00275441 predicted 1842
8 SASI_Mm01_00275442 predicted 2059
9 SASI_Mm01_00275443 predicted 1661
10 SASI_Mm01_00275444 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213365 predicted 1903
2 SASI_Mm01_00213366 predicted 2006
3 SASI_Mm01_00213367 predicted 1944
4 SASI_Mm01_00213368 predicted 2147
5 SASI_Mm01_00213369 predicted 2133
6 SASI_Mm01_00213370 predicted 1824
7 SASI_Mm01_00213371 predicted 2007
8 SASI_Mm01_00213372 predicted 2226
9 SASI_Mm01_00213373 predicted 1825
10 SASI_Mm01_00213374 predicted 2015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153612
HS3ST5 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-825s1c1
Sequence:CCGGGCCTCCAAGGATAAGTCAATACTCGAGTATTGACTTATCCTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-355s1c1
Sequence:CCGGGCCTCTCAAGAAATCCACTTTCTCGAGAAAGTGGATTTCTTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-648s1c1
Sequence:CCGGCCCTAATACATGCGAAGTGAACTCGAGTTCACTTCGCATGTATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-801s1c1
Sequence:CCGGGCTCGTGGAGAAGTTCCTAAACTCGAGTTTAGGAACTTCTCCACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-343s1c1
Sequence:CCGGGCAGTAGTCAAAGCCTCTCAACTCGAGTTGAGAGGCTTTGACTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153612
HS3ST5 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-825s1c1
Sequence:CCGGGCCTCCAAGGATAAGTCAATACTCGAGTATTGACTTATCCTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-355s1c1
Sequence:CCGGGCCTCTCAAGAAATCCACTTTCTCGAGAAAGTGGATTTCTTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-648s1c1
Sequence:CCGGCCCTAATACATGCGAAGTGAACTCGAGTTCACTTCGCATGTATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-801s1c1
Sequence:CCGGGCTCGTGGAGAAGTTCCTAAACTCGAGTTTAGGAACTTCTCCACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-343s1c1
Sequence:CCGGGCAGTAGTCAAAGCCTCTCAACTCGAGTTGAGAGGCTTTGACTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153612
HS3ST5 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-825s1c1
Sequence:CCGGGCCTCCAAGGATAAGTCAATACTCGAGTATTGACTTATCCTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-355s1c1
Sequence:CCGGGCCTCTCAAGAAATCCACTTTCTCGAGAAAGTGGATTTCTTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-648s1c1
Sequence:CCGGCCCTAATACATGCGAAGTGAACTCGAGTTCACTTCGCATGTATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-801s1c1
Sequence:CCGGGCTCGTGGAGAAGTTCCTAAACTCGAGTTTAGGAACTTCTCCACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153612.2-343s1c1
Sequence:CCGGGCAGTAGTCAAAGCCTCTCAACTCGAGTTGAGAGGCTTTGACTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081208
HS3ST5 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000254658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1967s21c1
Sequence:CCGGCATTACCAAATTGCGCAAATTCTCGAGAATTTGCGCAATTTGGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1839s21c1
Sequence:CCGGAGGATAAGTCAGTACAATTTACTCGAGTAAATTGTACTGACTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081208.1-2253s21c1
Sequence:CCGGGTTGCATCTGTTAAGCTATTTCTCGAGAAATAGCTTAACAGATGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1665s21c1
Sequence:CCGGTGTGAAGTGAACACGAAATACCTCGAGGTATTTCGTGTTCACTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081208
HS3ST5 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000254658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1967s21c1
Sequence:CCGGCATTACCAAATTGCGCAAATTCTCGAGAATTTGCGCAATTTGGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1839s21c1
Sequence:CCGGAGGATAAGTCAGTACAATTTACTCGAGTAAATTGTACTGACTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081208.1-2253s21c1
Sequence:CCGGGTTGCATCTGTTAAGCTATTTCTCGAGAAATAGCTTAACAGATGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1665s21c1
Sequence:CCGGTGTGAAGTGAACACGAAATACCTCGAGGTATTTCGTGTTCACTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081208
HS3ST5 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000254658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1967s21c1
Sequence:CCGGCATTACCAAATTGCGCAAATTCTCGAGAATTTGCGCAATTTGGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1839s21c1
Sequence:CCGGAGGATAAGTCAGTACAATTTACTCGAGTAAATTGTACTGACTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081208.1-2253s21c1
Sequence:CCGGGTTGCATCTGTTAAGCTATTTCTCGAGAAATAGCTTAACAGATGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081208.1-1665s21c1
Sequence:CCGGTGTGAAGTGAACACGAAATACCTCGAGGTATTTCGTGTTCACTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)