EMAIL THIS PAGE TO A FRIEND

HS3ST6

heparan sulfate (glucosamine) 3-O-sulfotransferase 6

43 Gene Product Result for
Synonyms: HS3ST5
UniProtKB ID: Q96QI5, Q96RX7
Gene ID:
Mouse(328779) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Rat(684979) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
chicken(427669) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
domestic cat(101083991) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
cow(540893) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Horse(100066938) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Domestic Rabbit(100346980) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
domestic guinea pig(100730401) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
naked mole-rat(101722336) heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48502 Anti-HS3ST6 antibody produced in rabbit affinity isolated antibody rat, mouse, human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000811 MISSION® esiRNA esiRNA targeting mouse Hs3st6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009606 Rosetta Predictions human pricing
NM_001109450 Rosetta Predictions rat pricing
NM_001012402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135273 predicted 370
2 SASI_Hs02_00305649 predicted 727
3 SASI_Hs01_00135276 predicted 301
4 SASI_Hs01_00135279 predicted 369
5 SASI_Hs02_00305650 predicted 471
6 SASI_Hs01_00135274 predicted 457
7 SASI_Hs01_00135281 predicted 623
8 SASI_Hs02_00305651 predicted 479
9 SASI_Hs01_00135282 predicted 415
10 SASI_Hs02_00305652 predicted 480
11 SASI_Hs01_00135275 predicted 567
12 SASI_Hs01_00135277 predicted 475
13 SASI_Hs01_00135278 predicted 467
14 SASI_Hs01_00135280 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248527 predicted 370
2 SASI_Rn02_00248528 predicted 651
3 SASI_Rn02_00248529 predicted 915
4 SASI_Rn02_00248530 predicted 918
5 SASI_Rn02_00248531 predicted 987
6 SASI_Rn02_00248532 predicted 517
7 SASI_Rn02_00248533 predicted 556
8 SASI_Rn02_00248534 predicted 764
9 SASI_Rn02_00248535 predicted 765
10 SASI_Rn02_00248536 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137891 predicted 645
2 SASI_Mm01_00137892 predicted 737
3 SASI_Mm01_00137893 predicted 537
4 SASI_Mm01_00137894 predicted 976
5 SASI_Mm01_00137895 predicted 545
6 SASI_Mm01_00137896 predicted 910
7 SASI_Mm01_00137898 predicted 786
8 SASI_Mm02_00287108 predicted 883
9 SASI_Mm01_00137899 predicted 912
10 SASI_Mm01_00137900 predicted 593
11 SASI_Mm01_00137897 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009606
HS3ST6 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-885s21c1
Sequence:CCGGCTTCAACCGCAGGTTCTACCACTCGAGTGGTAGAACCTGCGGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-698s21c1
Sequence:CCGGAGGACTTCCTGGGCCTGAAACCTCGAGGTTTCAGGCCCAGGAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-737s21c1
Sequence:CCGGACTTCTACTTCAACGCCACCACTCGAGTGGTGGCGTTGAAGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-185s21c1
Sequence:CCGGCGCTCATCGTTGGCGTGAAGACTCGAGTCTTCACGCCAACGATGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-280s21c1
Sequence:CCGGTTCTTCGACAGGTGCTACGAGCTCGAGCTCGTAGCACCTGTCGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009606
HS3ST6 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-885s21c1
Sequence:CCGGCTTCAACCGCAGGTTCTACCACTCGAGTGGTAGAACCTGCGGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-698s21c1
Sequence:CCGGAGGACTTCCTGGGCCTGAAACCTCGAGGTTTCAGGCCCAGGAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-737s21c1
Sequence:CCGGACTTCTACTTCAACGCCACCACTCGAGTGGTGGCGTTGAAGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-185s21c1
Sequence:CCGGCGCTCATCGTTGGCGTGAAGACTCGAGTCTTCACGCCAACGATGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-280s21c1
Sequence:CCGGTTCTTCGACAGGTGCTACGAGCTCGAGCTCGTAGCACCTGTCGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009606
HS3ST6 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-885s21c1
Sequence:CCGGCTTCAACCGCAGGTTCTACCACTCGAGTGGTAGAACCTGCGGTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-698s21c1
Sequence:CCGGAGGACTTCCTGGGCCTGAAACCTCGAGGTTTCAGGCCCAGGAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-737s21c1
Sequence:CCGGACTTCTACTTCAACGCCACCACTCGAGTGGTGGCGTTGAAGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-185s21c1
Sequence:CCGGCGCTCATCGTTGGCGTGAAGACTCGAGTCTTCACGCCAACGATGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009606.2-280s21c1
Sequence:CCGGTTCTTCGACAGGTGCTACGAGCTCGAGCTCGTAGCACCTGTCGAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012402
HS3ST6 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-181s1c1
Sequence:CCGGCGCTCGTAGTTCTGTTGCTAACTCGAGTTAGCAACAGAACTACGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-362s1c1
Sequence:CCGGGCTCATTGTGGGTGTGAAGAACTCGAGTTCTTCACACCCACAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-596s1c1
Sequence:CCGGCCCAGATACCAAGCTGATTGTCTCGAGACAATCAGCTTGGTATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-920s1c1
Sequence:CCGGCTTCAATGCTACTAAGGGCTTCTCGAGAAGCCCTTAGTAGCATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-873s1c1
Sequence:CCGGCAGGACTTTCTGGGTCTCAAACTCGAGTTTGAGACCCAGAAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012402
HS3ST6 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-181s1c1
Sequence:CCGGCGCTCGTAGTTCTGTTGCTAACTCGAGTTAGCAACAGAACTACGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-362s1c1
Sequence:CCGGGCTCATTGTGGGTGTGAAGAACTCGAGTTCTTCACACCCACAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-596s1c1
Sequence:CCGGCCCAGATACCAAGCTGATTGTCTCGAGACAATCAGCTTGGTATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-920s1c1
Sequence:CCGGCTTCAATGCTACTAAGGGCTTCTCGAGAAGCCCTTAGTAGCATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-873s1c1
Sequence:CCGGCAGGACTTTCTGGGTCTCAAACTCGAGTTTGAGACCCAGAAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012402
HS3ST6 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-181s1c1
Sequence:CCGGCGCTCGTAGTTCTGTTGCTAACTCGAGTTAGCAACAGAACTACGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-362s1c1
Sequence:CCGGGCTCATTGTGGGTGTGAAGAACTCGAGTTCTTCACACCCACAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-596s1c1
Sequence:CCGGCCCAGATACCAAGCTGATTGTCTCGAGACAATCAGCTTGGTATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-920s1c1
Sequence:CCGGCTTCAATGCTACTAAGGGCTTCTCGAGAAGCCCTTAGTAGCATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012402.1-873s1c1
Sequence:CCGGCAGGACTTTCTGGGTCTCAAACTCGAGTTTGAGACCCAGAAAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)