EMAIL THIS PAGE TO A FRIEND

HS6ST1

heparan sulfate 6-O-sulfotransferase 1

51 Gene Product Result for
Synonyms: HH15 HS6ST
UniProtKB ID: O60243, B4DEP2, B4DJ29, Q53SL2, Q9BVI1
Gene ID:
Human(9394) Summary: The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(50785) heparan sulfate 6-O-sulfotransferase 1
Rat(316325) heparan sulfate 6-O-sulfotransferase 1
chicken(395141) heparan sulfate 6-O-sulfotransferase 1
cow(518563) heparan sulfate 6-O-sulfotransferase 1
domestic cat(101091388) heparan sulfate 6-O-sulfotransferase 1
dog(100688113) heparan sulfate 6-O-sulfotransferase 1
domestic guinea pig(100720104) heparan sulfate 6-O-sulfotransferase 1
naked mole-rat(101717791) heparan sulfate 6-O-sulfotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004807 Rosetta Predictions human pricing
NM_001108210 Rosetta Predictions rat pricing
NM_015818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039716 predicted 1634
2 SASI_Hs01_00039717 predicted 932
3 SASI_Hs01_00039718 predicted 927
4 SASI_Hs01_00039720 predicted 1061
5 SASI_Hs02_00338350 predicted 635
6 SASI_Hs01_00039722 predicted 973
7 SASI_Hs01_00039723 predicted 946
8 SASI_Hs02_00338351 predicted 639
9 SASI_Hs01_00039719 predicted 1648
10 SASI_Hs02_00338352 predicted 730
11 SASI_Hs01_00039715 predicted 721
12 SASI_Hs01_00039721 predicted 718
13 SASI_Hs01_00039724 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236404 predicted 1346
2 SASI_Rn02_00236405 predicted 1102
3 SASI_Rn02_00236406 predicted 729
4 SASI_Rn02_00236407 predicted 701
5 SASI_Rn02_00236408 predicted 382
6 SASI_Rn02_00236409 predicted 282
7 SASI_Rn02_00236410 predicted 716
8 SASI_Rn02_00236411 predicted 1512
9 SASI_Rn02_00236412 predicted 590
10 SASI_Rn02_00236413 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066864 predicted 1132
2 SASI_Mm01_00066865 predicted 1910
3 SASI_Mm01_00066866 predicted 1023
4 SASI_Mm01_00066868 predicted 816
5 SASI_Mm01_00066869 predicted 1761
6 SASI_Mm01_00066870 predicted 1152
7 SASI_Mm01_00066871 predicted 1312
8 SASI_Mm01_00066872 predicted 1499
9 SASI_Mm02_00323220 predicted 1445
10 SASI_Mm02_00323221 predicted 1343
11 SASI_Mm01_00066867 predicted 1187
12 SASI_Mm01_00066873 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015818
HS6ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015818.1-1908s1c1
Sequence:CCGGCCCACCTATCAAAGCTGCTTTCTCGAGAAAGCAGCTTTGATAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1185s1c1
Sequence:CCGGCATCCGGCCATTCATGCAATACTCGAGTATTGCATGAATGGCCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1458s1c1
Sequence:CCGGCATGAGCCATATCATTGAGAACTCGAGTTCTCAATGATATGGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1188s1c1
Sequence:CCGGCCGGCCATTCATGCAATACAACTCGAGTTGTATTGCATGAATGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-771s1c1
Sequence:CCGGGCCCAGAAAGTTCTACTACATCTCGAGATGTAGTAGAACTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015818
HS6ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015818.1-1908s1c1
Sequence:CCGGCCCACCTATCAAAGCTGCTTTCTCGAGAAAGCAGCTTTGATAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1185s1c1
Sequence:CCGGCATCCGGCCATTCATGCAATACTCGAGTATTGCATGAATGGCCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1458s1c1
Sequence:CCGGCATGAGCCATATCATTGAGAACTCGAGTTCTCAATGATATGGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1188s1c1
Sequence:CCGGCCGGCCATTCATGCAATACAACTCGAGTTGTATTGCATGAATGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-771s1c1
Sequence:CCGGGCCCAGAAAGTTCTACTACATCTCGAGATGTAGTAGAACTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015818
HS6ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015818.1-1908s1c1
Sequence:CCGGCCCACCTATCAAAGCTGCTTTCTCGAGAAAGCAGCTTTGATAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1185s1c1
Sequence:CCGGCATCCGGCCATTCATGCAATACTCGAGTATTGCATGAATGGCCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1458s1c1
Sequence:CCGGCATGAGCCATATCATTGAGAACTCGAGTTCTCAATGATATGGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-1188s1c1
Sequence:CCGGCCGGCCATTCATGCAATACAACTCGAGTTGTATTGCATGAATGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015818.1-771s1c1
Sequence:CCGGGCCCAGAAAGTTCTACTACATCTCGAGATGTAGTAGAACTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004807
HS6ST1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-369s1c1
Sequence:CCGGCGTGATCGTCTTCCTGCACATCTCGAGATGTGCAGGAAGACGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1048s1c1
Sequence:CCGGCGGCCCTTCATGCAGTACAATCTCGAGATTGTACTGCATGAAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-294s1c1
Sequence:CCGGCCACTACGAGAAGAAGTACTACTCGAGTAGTACTTCTTCTCGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-891s1c1
Sequence:CCGGCTGCTACAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1308s1c1
Sequence:CCGGCGAGGACTACATGAGCCACATCTCGAGATGTGGCTCATGTAGTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004807.2-1636s21c1
Sequence:CCGGGTGTGTCCCTCACCAACTATGCTCGAGCATAGTTGGTGAGGGACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-643s21c1
Sequence:CCGGGTGGAAGACGTCGTTGCATATCTCGAGATATGCAACGACGTCTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-952s21c1
Sequence:CCGGGACGTTCAACCTCAAGTTCATCTCGAGATGAACTTGAGGTTGAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004807
HS6ST1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-369s1c1
Sequence:CCGGCGTGATCGTCTTCCTGCACATCTCGAGATGTGCAGGAAGACGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1048s1c1
Sequence:CCGGCGGCCCTTCATGCAGTACAATCTCGAGATTGTACTGCATGAAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-294s1c1
Sequence:CCGGCCACTACGAGAAGAAGTACTACTCGAGTAGTACTTCTTCTCGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-891s1c1
Sequence:CCGGCTGCTACAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1308s1c1
Sequence:CCGGCGAGGACTACATGAGCCACATCTCGAGATGTGGCTCATGTAGTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004807.2-1636s21c1
Sequence:CCGGGTGTGTCCCTCACCAACTATGCTCGAGCATAGTTGGTGAGGGACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-643s21c1
Sequence:CCGGGTGGAAGACGTCGTTGCATATCTCGAGATATGCAACGACGTCTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-952s21c1
Sequence:CCGGGACGTTCAACCTCAAGTTCATCTCGAGATGAACTTGAGGTTGAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004807
HS6ST1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-369s1c1
Sequence:CCGGCGTGATCGTCTTCCTGCACATCTCGAGATGTGCAGGAAGACGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1048s1c1
Sequence:CCGGCGGCCCTTCATGCAGTACAATCTCGAGATTGTACTGCATGAAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-294s1c1
Sequence:CCGGCCACTACGAGAAGAAGTACTACTCGAGTAGTACTTCTTCTCGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-891s1c1
Sequence:CCGGCTGCTACAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004807.1-1308s1c1
Sequence:CCGGCGAGGACTACATGAGCCACATCTCGAGATGTGGCTCATGTAGTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004807.2-1636s21c1
Sequence:CCGGGTGTGTCCCTCACCAACTATGCTCGAGCATAGTTGGTGAGGGACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-643s21c1
Sequence:CCGGGTGGAAGACGTCGTTGCATATCTCGAGATATGCAACGACGTCTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004807.2-952s21c1
Sequence:CCGGGACGTTCAACCTCAAGTTCATCTCGAGATGAACTTGAGGTTGAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)