EMAIL THIS PAGE TO A FRIEND

HS6ST1P1

heparan sulfate 6-O-sulfotransferase 1 pseudogene 1

Gene Product Result for
Synonyms: HS6ST1P
Species: Human HS6ST1P1(388605)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371230
HS6ST1P1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 1 pseudogene 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000034564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-637s1c1
Sequence:CCGGGCCCAGGAAGTTCTACTACATCTCGAGATGTAGTAGAACTTCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-1330s1c1
Sequence:CCGGCCACATCATTGAGAAGTGGTACTCGAGTACCACTTCTCAATGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-199s1c1
Sequence:CCGGCATGCTCATCTTGTACCAGTACTCGAGTACTGGTACAAGATGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-301s1c1
Sequence:CCGGCCACTACGAGAAGAAGCACTACTCGAGTAGTGCTTCTTCTCGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371230
HS6ST1P1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 1 pseudogene 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000034564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-637s1c1
Sequence:CCGGGCCCAGGAAGTTCTACTACATCTCGAGATGTAGTAGAACTTCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-1330s1c1
Sequence:CCGGCCACATCATTGAGAAGTGGTACTCGAGTACCACTTCTCAATGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-199s1c1
Sequence:CCGGCATGCTCATCTTGTACCAGTACTCGAGTACTGGTACAAGATGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-301s1c1
Sequence:CCGGCCACTACGAGAAGAAGCACTACTCGAGTAGTGCTTCTTCTCGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371230
HS6ST1P1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 1 pseudogene 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000034564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-637s1c1
Sequence:CCGGGCCCAGGAAGTTCTACTACATCTCGAGATGTAGTAGAACTTCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-1330s1c1
Sequence:CCGGCCACATCATTGAGAAGTGGTACTCGAGTACCACTTCTCAATGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-199s1c1
Sequence:CCGGCATGCTCATCTTGTACCAGTACTCGAGTACTGGTACAAGATGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371230.1-301s1c1
Sequence:CCGGCCACTACGAGAAGAAGCACTACTCGAGTAGTGCTTCTTCTCGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)