EMAIL THIS PAGE TO A FRIEND

HS6ST2

heparan sulfate 6-O-sulfotransferase 2

194 Gene Product Result for
Gene ID:
Human(90161) Summary: Heparan sulfate proteoglycans are ubiquitous components of the cell surface, extracellular matrix, and basement membranes, and interact with various ligands to influence cell growth, differentiation, adhesion, and migration. This gene encodes a member of the heparan sulfate (HS) sulfotransferase gene family, which catalyze the transfer of sulfate to HS. Different family members and isoforms are thought to synthesize heparan sulfates with tissue-specific structures and functions. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(50786) heparan sulfate 6-O-sulfotransferase 2
Rat(302489) heparan sulfate 6-O-sulfotransferase 2
Zebrafish(378450) heparan sulfate 6-O-sulfotransferase 2
domestic cat(101094001) heparan sulfate 6-O-sulfotransferase 2
cow(517768) heparan sulfate 6-O-sulfotransferase 2
Horse(100054266) heparan sulfate 6-O-sulfotransferase 2
dog(492142) heparan sulfate 6-O-sulfotransferase 2
chicken(395150) heparan sulfate 6-O-sulfotransferase 2
sheep(101110034) heparan sulfate 6-O-sulfotransferase 2
Domestic Rabbit(100351196) heparan sulfate 6-O-sulfotransferase 2
domestic guinea pig(100721660) heparan sulfate 6-O-sulfotransferase 2
naked mole-rat(101710022) heparan sulfate 6-O-sulfotransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077188 Rosetta Predictions human pricing
NM_147175 Rosetta Predictions human pricing
XM_228681 Rosetta Predictions rat pricing
NM_001077202 Rosetta Predictions mouse pricing
NM_015819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312124 predicted 1818
2 SASI_Hs02_00312125 predicted 1931
3 SASI_Hs02_00312126 predicted 1890
4 SASI_Hs02_00312127 predicted 2028
5 SASI_Hs02_00312128 predicted 1879
6 SASI_Hs02_00312129 predicted 1982
7 SASI_Hs02_00312130 predicted 1892
8 SASI_Hs02_00312131 predicted 1954
9 SASI_Hs02_00312132 predicted 1985
10 SASI_Hs02_00312133 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160022 predicted 1693
2 SASI_Hs01_00160023 predicted 1817
3 SASI_Hs01_00160024 predicted 1777
4 SASI_Hs01_00160025 predicted 1908
5 SASI_Hs01_00160026 predicted 1756
6 SASI_Hs01_00160027 predicted 1863
7 SASI_Hs02_00365515 predicted 1772
8 SASI_Hs02_00365516 predicted 1839
9 SASI_Hs02_00365517 predicted 1863
10 SASI_Hs02_00365518 predicted 2050
11 SASI_Hs01_00160028 predicted 1810
12 SASI_Hs01_00160029 predicted 1546
13 SASI_Hs01_00160030 predicted 1626
14 SASI_Hs01_00160031 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385390 predicted 1713
2 SASI_Rn02_00385391 predicted 1420
3 SASI_Rn02_00385392 predicted 1616
4 SASI_Rn02_00385393 predicted 534
5 SASI_Rn02_00385394 predicted 1684
6 SASI_Rn02_00385395 predicted 1871
7 SASI_Rn02_00385396 predicted 1643
8 SASI_Rn02_00385397 predicted 1559
9 SASI_Rn02_00385398 predicted 1902
10 SASI_Rn02_00385399 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292422 predicted 1561
2 SASI_Mm02_00292423 predicted 1458
3 SASI_Mm02_00292424 predicted 1321
4 SASI_Mm02_00292425 predicted 1502
5 SASI_Mm02_00292426 predicted 1516
6 SASI_Mm02_00292427 predicted 1807
7 SASI_Mm02_00292428 predicted 1541
8 SASI_Mm02_00292429 predicted 1798
9 SASI_Mm02_00292430 predicted 1609
10 SASI_Mm02_00292431 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126629 predicted 1086
2 SASI_Mm01_00126630 predicted 973
3 SASI_Mm01_00126631 predicted 836
4 SASI_Mm01_00126632 predicted 1023
5 SASI_Mm02_00323222 predicted 1044
6 SASI_Mm01_00126634 predicted 1334
7 SASI_Mm01_00126635 predicted 1060
8 SASI_Mm01_00126636 predicted 1318
9 SASI_Mm01_00126637 predicted 1124
10 SASI_Mm01_00126638 predicted 1199
11 SASI_Mm01_00126633 predicted 1120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015819
VALIDATED
HS6ST2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1577s1c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-43s1c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015819.1-1345s1c1
Sequence:CCGGCCCAAATCAGAACCTGACTCACTCGAGTGAGTCAGGTTCTGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1154s1c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1112s21c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1180s21c1
Sequence:CCGGGCGTCAGGAGCAACGCAAATTCTCGAGAATTTGCGTTGCTCCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1044s1c1
Sequence:CCGGCGCCGTTTACCCAGTATAATACTCGAGTATTATACTGGGTAAACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-121s21c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1001s21c1
Sequence:CCGGTCGCCGTTTACCCAGTATAATCTCGAGATTATACTGGGTAAACGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015819.3-1535s21c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015819
VALIDATED
HS6ST2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1577s1c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-43s1c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015819.1-1345s1c1
Sequence:CCGGCCCAAATCAGAACCTGACTCACTCGAGTGAGTCAGGTTCTGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1154s1c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1112s21c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1180s21c1
Sequence:CCGGGCGTCAGGAGCAACGCAAATTCTCGAGAATTTGCGTTGCTCCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1044s1c1
Sequence:CCGGCGCCGTTTACCCAGTATAATACTCGAGTATTATACTGGGTAAACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-121s21c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1001s21c1
Sequence:CCGGTCGCCGTTTACCCAGTATAATCTCGAGATTATACTGGGTAAACGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015819.3-1535s21c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015819
VALIDATED
HS6ST2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1577s1c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-43s1c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015819.1-1345s1c1
Sequence:CCGGCCCAAATCAGAACCTGACTCACTCGAGTGAGTCAGGTTCTGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1154s1c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1112s21c1
Sequence:CCGGGCTAAAGACCTCTTTCTGCAACTCGAGTTGCAGAAAGAGGTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1180s21c1
Sequence:CCGGGCGTCAGGAGCAACGCAAATTCTCGAGAATTTGCGTTGCTCCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015819.1-1044s1c1
Sequence:CCGGCGCCGTTTACCCAGTATAATACTCGAGTATTATACTGGGTAAACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-121s21c1
Sequence:CCGGGCTCTTCCTATTTGCGGTGATCTCGAGATCACCGCAAATAGGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015819.3-1001s21c1
Sequence:CCGGTCGCCGTTTACCCAGTATAATCTCGAGATTATACTGGGTAAACGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015819.3-1535s21c1
Sequence:CCGGCGTGTATCTTACAAGATGAAACTCGAGTTTCATCTTGTAAGATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147174
VALIDATED
HS6ST2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1082s1c1
Sequence:CCGGGCCTCTAGTGTAGAGATCAATCTCGAGATTGATCTCTACACTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-161s1c1
Sequence:CCGGGCTTTGGTGATGCTCTTCCTACTCGAGTAGGAAGAGCATCACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1447s1c1
Sequence:CCGGGCAGAATGATAACACCAGCAACTCGAGTTGCTGGTGTTATCATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-1232s1c1
Sequence:CCGGCGTCAGGAACAACGCAAATTTCTCGAGAAATTTGCGTTGTTCCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1378s1c1
Sequence:CCGGGCAGAATCTGACTCAGAGTTTCTCGAGAAACTCTGAGTCAGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147174
VALIDATED
HS6ST2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1082s1c1
Sequence:CCGGGCCTCTAGTGTAGAGATCAATCTCGAGATTGATCTCTACACTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-161s1c1
Sequence:CCGGGCTTTGGTGATGCTCTTCCTACTCGAGTAGGAAGAGCATCACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1447s1c1
Sequence:CCGGGCAGAATGATAACACCAGCAACTCGAGTTGCTGGTGTTATCATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-1232s1c1
Sequence:CCGGCGTCAGGAACAACGCAAATTTCTCGAGAAATTTGCGTTGTTCCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1378s1c1
Sequence:CCGGGCAGAATCTGACTCAGAGTTTCTCGAGAAACTCTGAGTCAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147174
VALIDATED
HS6ST2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1082s1c1
Sequence:CCGGGCCTCTAGTGTAGAGATCAATCTCGAGATTGATCTCTACACTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-161s1c1
Sequence:CCGGGCTTTGGTGATGCTCTTCCTACTCGAGTAGGAAGAGCATCACCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1447s1c1
Sequence:CCGGGCAGAATGATAACACCAGCAACTCGAGTTGCTGGTGTTATCATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147174.2-1232s1c1
Sequence:CCGGCGTCAGGAACAACGCAAATTTCTCGAGAAATTTGCGTTGTTCCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_147174.2-1378s1c1
Sequence:CCGGGCAGAATCTGACTCAGAGTTTCTCGAGAAACTCTGAGTCAGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)