EMAIL THIS PAGE TO A FRIEND

HS6ST3

heparan sulfate 6-O-sulfotransferase 3

250 Gene Product Result for
Synonyms: HS6ST-3
UniProtKB ID: Q8IZP7, Q5W0L0, Q68CW6
Gene ID:
Human(266722) Summary: Heparan sulfate (HS) sulfotransferases, such as HS6ST3, modify HS to generate structures required for interactions between HS and a variety of proteins. These interactions are implicated in proliferation and differentiation, adhesion, migration, inflammation, blood coagulation, and other diverse processes (Habuchi et al., 2000 [PubMed 10644753]
Mouse(50787) heparan sulfate 6-O-sulfotransferase 3
Rat(364476) heparan sulfate 6-O-sulfotransferase 3
chicken(428025) heparan sulfate 6-O-sulfotransferase 3
cow(538566) heparan sulfate 6-O-sulfotransferase 3
domestic cat(101099678) heparan sulfate 6-O-sulfotransferase 3
dog(485526) heparan sulfate 6-O-sulfotransferase 3
domestic guinea pig(100716299) heparan sulfate 6-O-sulfotransferase 3
naked mole-rat(101711181) heparan sulfate 6-O-sulfotransferase 3
sheep(101110949) heparan sulfate 6-O-sulfotransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101082 Anti-HS6ST3 antibody produced in rabbit affinity isolated antibody zebrafish, bovine, guinea pig, rabbit, mouse, horse, rat, human
western blot pricing
HPA078257 Anti-HS6ST3 from rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153456 Rosetta Predictions human pricing
XM_001078574 Rosetta Predictions rat pricing
XM_344461 Rosetta Predictions rat pricing
NM_015820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202627 predicted 922
2 SASI_Hs01_00202629 predicted 817
3 SASI_Hs01_00202630 predicted 1168
4 SASI_Hs01_00202631 predicted 1018
5 SASI_Hs01_00202632 predicted 987
6 SASI_Hs01_00202633 predicted 770
7 SASI_Hs01_00202634 predicted 903
8 SASI_Hs01_00202635 predicted 1843
9 SASI_Hs01_00202636 predicted 1201
10 SASI_Hs02_00367297 predicted 1103
11 SASI_Hs01_00202628 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361299 predicted 404
2 SASI_Rn02_00361300 predicted 593
3 SASI_Rn02_00361301 predicted 372
4 SASI_Rn02_00361302 predicted 512
5 SASI_Rn02_00361303 predicted 479
6 SASI_Rn02_00361304 predicted 383
7 SASI_Rn02_00361305 predicted 512
8 SASI_Rn02_00361306 predicted 425
9 SASI_Rn02_00361307 predicted 497
10 SASI_Rn02_00361308 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397131 predicted 204
2 SASI_Rn02_00397132 predicted 207
3 SASI_Rn02_00397133 predicted 203
4 SASI_Rn02_00397134 predicted 220
5 SASI_Rn02_00397135 predicted 204
6 SASI_Rn02_00397136 predicted 211
7 SASI_Rn02_00397137 predicted 208
8 SASI_Rn02_00397138 predicted 212
9 SASI_Rn02_00397139 predicted 201
10 SASI_Rn02_00397140 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105592 predicted 1310
2 SASI_Mm01_00105593 predicted 902
3 SASI_Mm01_00105594 predicted 1066
4 SASI_Mm01_00105595 predicted 805
5 SASI_Mm01_00105596 predicted 1180
6 SASI_Mm01_00105597 predicted 1203
7 SASI_Mm01_00105598 predicted 1165
8 SASI_Mm01_00105599 predicted 1012
9 SASI_Mm01_00105600 predicted 1077
10 SASI_Mm01_00105601 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153456
HS6ST3 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153456.2-1587s21c1
Sequence:CCGGTTTATCCAGCTGGAGATTATCCTCGAGGATAATCTCCAGCTGGATAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-900s21c1
Sequence:CCGGGGTCAGCTTGCGGGAGTTTATCTCGAGATAAACTCCCGCAAGCTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-985s21c1
Sequence:CCGGGGCTGCTATAACTTGACTTTCCTCGAGGAAAGTCAAGTTATAGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-78s1c1
Sequence:CCGGCGTGGTCATCATGTACCAGTACTCGAGTACTGGTACATGATGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-723s1c1
Sequence:CCGGCCACACCAGGAATTTCTATTACTCGAGTAATAGAAATTCCTGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1239s1c1
Sequence:CCGGGCAGCTTTACGAGTATGCAAACTCGAGTTTGCATACTCGTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1011s1c1
Sequence:CCGGCGAGAGTGAAAGAAACACCATCTCGAGATGGTGTTTCTTTCACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1206s1c1
Sequence:CCGGCCAACGCATTGAGGATCTAAACTCGAGTTTAGATCCTCAATGCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153456
HS6ST3 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153456.2-1587s21c1
Sequence:CCGGTTTATCCAGCTGGAGATTATCCTCGAGGATAATCTCCAGCTGGATAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-900s21c1
Sequence:CCGGGGTCAGCTTGCGGGAGTTTATCTCGAGATAAACTCCCGCAAGCTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-985s21c1
Sequence:CCGGGGCTGCTATAACTTGACTTTCCTCGAGGAAAGTCAAGTTATAGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-78s1c1
Sequence:CCGGCGTGGTCATCATGTACCAGTACTCGAGTACTGGTACATGATGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-723s1c1
Sequence:CCGGCCACACCAGGAATTTCTATTACTCGAGTAATAGAAATTCCTGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1239s1c1
Sequence:CCGGGCAGCTTTACGAGTATGCAAACTCGAGTTTGCATACTCGTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1011s1c1
Sequence:CCGGCGAGAGTGAAAGAAACACCATCTCGAGATGGTGTTTCTTTCACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1206s1c1
Sequence:CCGGCCAACGCATTGAGGATCTAAACTCGAGTTTAGATCCTCAATGCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153456
HS6ST3 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153456.2-1587s21c1
Sequence:CCGGTTTATCCAGCTGGAGATTATCCTCGAGGATAATCTCCAGCTGGATAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-900s21c1
Sequence:CCGGGGTCAGCTTGCGGGAGTTTATCTCGAGATAAACTCCCGCAAGCTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153456.2-985s21c1
Sequence:CCGGGGCTGCTATAACTTGACTTTCCTCGAGGAAAGTCAAGTTATAGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-78s1c1
Sequence:CCGGCGTGGTCATCATGTACCAGTACTCGAGTACTGGTACATGATGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-723s1c1
Sequence:CCGGCCACACCAGGAATTTCTATTACTCGAGTAATAGAAATTCCTGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1239s1c1
Sequence:CCGGGCAGCTTTACGAGTATGCAAACTCGAGTTTGCATACTCGTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1011s1c1
Sequence:CCGGCGAGAGTGAAAGAAACACCATCTCGAGATGGTGTTTCTTTCACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153456.2-1206s1c1
Sequence:CCGGCCAACGCATTGAGGATCTAAACTCGAGTTTAGATCCTCAATGCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015820
HS6ST3 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate 6-O-sulfotransferase 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000103225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015820.1-1571s1c1
Sequence:CCGGCCTCCTTCTCTTGGATTACTTCTCGAGAAGTAATCCAAGAGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1260s1c1
Sequence:CCGGGCATCCAACGTGGACATCAATCTCGAGATTGATGTCCACGTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1325s1c1
Sequence:CCGGGCAGCTTTATGAGTATGCGAACTCGAGTTCGCATACTCATAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-818s1c1
Sequence:CCGGGAATTTCTACTACATCACGATCTCGAGATCGTGATGTAGTAGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015820
HS6ST3 MISSION shRNA shRNA Plasmid DNA
heparan sulfate 6-O-sulfotransferase 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000103225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015820.1-1571s1c1
Sequence:CCGGCCTCCTTCTCTTGGATTACTTCTCGAGAAGTAATCCAAGAGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1260s1c1
Sequence:CCGGGCATCCAACGTGGACATCAATCTCGAGATTGATGTCCACGTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1325s1c1
Sequence:CCGGGCAGCTTTATGAGTATGCGAACTCGAGTTCGCATACTCATAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-818s1c1
Sequence:CCGGGAATTTCTACTACATCACGATCTCGAGATCGTGATGTAGTAGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015820
HS6ST3 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate 6-O-sulfotransferase 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000103225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015820.1-1571s1c1
Sequence:CCGGCCTCCTTCTCTTGGATTACTTCTCGAGAAGTAATCCAAGAGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1260s1c1
Sequence:CCGGGCATCCAACGTGGACATCAATCTCGAGATTGATGTCCACGTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-1325s1c1
Sequence:CCGGGCAGCTTTATGAGTATGCGAACTCGAGTTCGCATACTCATAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015820.1-818s1c1
Sequence:CCGGGAATTTCTACTACATCACGATCTCGAGATCGTGATGTAGTAGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)