EMAIL THIS PAGE TO A FRIEND

HSBP1

heat shock factor binding protein 1

46 Gene Product Result for
Synonyms: NPC-A-13
UniProtKB ID: O75506, Q53XA8, Q7Z5Z3
Gene ID:
Human(3281) Summary: The heat-shock response is elicited by exposure of cells to thermal and chemical stress and through the activation of HSFs (heat shock factors) results in the elevated expression of heat-shock induced genes. Heat shock factor binding protein 1 (HSBP1), is a 76-amino-acid protein that binds to heat shock factor 1(HSF1), which is a transcription factor involved in the HS response. During HS response, HSF1 undergoes conformational transition from an inert non-DNA-binding monomer to active functional trimers. HSBP1 is nuclear-localized and interacts with the active trimeric state of HSF1 to negatively regulate HSF1 DNA-binding activity. Overexpression of HSBP1 in mammalian cells represses the transactivation activity of HSF1. When overexpressed in C.elegans HSBP1 has severe effects on survival of the animals after thermal and chemical stress consistent with a role of HSBP1 as a negative regulator of heat shock response. [provided by RefSeq, Jul 2008]
Mouse(68196) heat shock factor binding protein 1
Rat(286899) heat shock factor binding protein 1
chicken(415813) heat shock factor binding protein 1
cow(767979) heat shock factor binding protein 1
dog(609752) heat shock factor binding protein 1
sheep(101122048) heat shock factor binding protein 1
domestic guinea pig(100728473) heat shock factor binding protein 1
naked mole-rat(101716916) heat shock factor binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001537 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001537 Rosetta Predictions human pricing
NM_173119 Rosetta Predictions rat pricing
NM_024219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232417 predicted 286
2 SASI_Hs01_00232418 predicted 454
3 SASI_Hs01_00232419 predicted 426
4 SASI_Hs01_00232420 predicted 629
5 SASI_Hs01_00232421 predicted 188
6 SASI_Hs01_00232422 predicted 776
7 SASI_Hs01_00232423 predicted 701
8 SASI_Hs01_00232424 predicted 706
9 SASI_Hs01_00232425 predicted 441
10 SASI_Hs01_00232426 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119146 predicted 339
2 SASI_Rn01_00119147 predicted 488
3 SASI_Rn01_00119149 predicted 547
4 SASI_Rn01_00119150 predicted 456
5 SASI_Rn01_00119151 predicted 442
6 SASI_Rn02_00269274 predicted 739
7 SASI_Rn01_00119152 predicted 673
8 SASI_Rn01_00119153 predicted 317
9 SASI_Rn01_00119154 predicted 489
10 SASI_Rn01_00119155 predicted 264
11 SASI_Rn01_00119148 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150714 predicted 552
2 SASI_Mm01_00150715 predicted 319
3 SASI_Mm02_00327588 predicted 345
4 SASI_Mm01_00150716 predicted 719
5 SASI_Mm01_00150718 predicted 325
6 SASI_Mm01_00150719 predicted 620
7 SASI_Mm01_00150720 predicted 435
8 SASI_Mm02_00327589 predicted 719
9 SASI_Mm01_00150721 predicted 259
10 SASI_Mm02_00327590 predicted 437
11 SASI_Mm01_00150713 predicted 415
12 SASI_Mm01_00150717 predicted 344
13 SASI_Mm01_00150722 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024219
VALIDATED
HSBP1 MISSION shRNA Bacterial Glycerol Stock
heat shock factor binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024219.1-277s21c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024219.1-277s1c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-132s1c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024219.1-179s1c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-153s1c1
Sequence:CCGGGATGACATGAGCAGTCGGATTCTCGAGAATCCGACTGCTCATGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-98s1c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-179s21c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-132s21c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-98s21c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024219
VALIDATED
HSBP1 MISSION shRNA shRNA Plasmid DNA
heat shock factor binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024219.1-277s21c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024219.1-277s1c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-132s1c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024219.1-179s1c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-153s1c1
Sequence:CCGGGATGACATGAGCAGTCGGATTCTCGAGAATCCGACTGCTCATGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-98s1c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-179s21c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-132s21c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-98s21c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024219
VALIDATED
HSBP1 MISSION shRNA Lentiviral Transduction Particles
heat shock factor binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024219.1-277s21c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024219.1-277s1c1
Sequence:CCGGCGGTACTGAATCCAGAATGTTCTCGAGAACATTCTGGATTCAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-132s1c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024219.1-179s1c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-153s1c1
Sequence:CCGGGATGACATGAGCAGTCGGATTCTCGAGAATCCGACTGCTCATGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024219.1-98s1c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-179s21c1
Sequence:CCGGCCTGGAGAAGAATATCGCTGACTCGAGTCAGCGATATTCTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-132s21c1
Sequence:CCGGGACCAGATCATCGGAAGGATACTCGAGTATCCTTCCGATGATCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024219.1-98s21c1
Sequence:CCGGGCAGCAGATGCAAGACAAGTTCTCGAGAACTTGTCTTGCATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001537
VALIDATED
HSBP1 MISSION shRNA Bacterial Glycerol Stock
heat shock factor binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-168s1c1
Sequence:CCGGTGATGATATGAGTAGTCGCATCTCGAGATGCGACTACTCATATCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-257s1c1
Sequence:CCGGACAAGATACCTGCCACGCAAACTCGAGTTTGCGTGGCAGGTATCTTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-117s1c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-138s1c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-151s1c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-556s21c1
Sequence:CCGGGGCGGTTCTTGCATAACATTGCTCGAGCAATGTTATGCAAGAACCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-314s21c1
Sequence:CCGGGAGTTGAAGGTTGCTAATAATCTCGAGATTATTAGCAACCTTCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-173s21c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-186s21c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-152s21c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001537
VALIDATED
HSBP1 MISSION shRNA shRNA Plasmid DNA
heat shock factor binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-168s1c1
Sequence:CCGGTGATGATATGAGTAGTCGCATCTCGAGATGCGACTACTCATATCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-257s1c1
Sequence:CCGGACAAGATACCTGCCACGCAAACTCGAGTTTGCGTGGCAGGTATCTTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-117s1c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-138s1c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-151s1c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-556s21c1
Sequence:CCGGGGCGGTTCTTGCATAACATTGCTCGAGCAATGTTATGCAAGAACCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-314s21c1
Sequence:CCGGGAGTTGAAGGTTGCTAATAATCTCGAGATTATTAGCAACCTTCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-173s21c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-186s21c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-152s21c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001537
VALIDATED
HSBP1 MISSION shRNA Lentiviral Transduction Particles
heat shock factor binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-168s1c1
Sequence:CCGGTGATGATATGAGTAGTCGCATCTCGAGATGCGACTACTCATATCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-257s1c1
Sequence:CCGGACAAGATACCTGCCACGCAAACTCGAGTTTGCGTGGCAGGTATCTTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001537.1-117s1c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-138s1c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001537.1-151s1c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-556s21c1
Sequence:CCGGGGCGGTTCTTGCATAACATTGCTCGAGCAATGTTATGCAAGAACCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-314s21c1
Sequence:CCGGGAGTTGAAGGTTGCTAATAATCTCGAGATTATTAGCAACCTTCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-173s21c1
Sequence:CCGGGACCATGTCTGACCAGATCATCTCGAGATGATCTGGTCAGACATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-186s21c1
Sequence:CCGGCAGATCATTGGGAGAATTGATCTCGAGATCAATTCTCCCAATGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001537.2-152s21c1
Sequence:CCGGGCAGATGCAAGATAAATTTCACTCGAGTGAAATTTATCTTGCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)