EMAIL THIS PAGE TO A FRIEND

HSBP1L1

heat shock factor binding protein 1-like 1

39 Gene Product Result for
UniProtKB ID: C9JCN9, B2RXG9
Gene ID:
Mouse(66255) heat shock factor binding protein 1-like 1
Rat(100192205) heat shock factor binding protein 1-like 1
chicken(420812) heat shock factor binding protein 1-like 1
cow(100335435) heat shock factor binding protein 1-like 1
dog(100686180) heat shock factor binding protein 1-like 1
domestic guinea pig(100733935) heat shock factor binding protein 1-like 1
naked mole-rat(101724263) heat shock factor binding protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048273 Anti-HSBP1L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001136181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001136181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001136181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_498704 Rosetta Predictions human pricing
XM_885191 Rosetta Predictions mouse pricing
XM_917141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249426 predicted 212
2 SASI_Hs01_00249427 predicted 111
3 SASI_Hs01_00249428 predicted 114
4 SASI_Hs01_00249429 predicted 206
5 SASI_Hs01_00249430 predicted 211
6 SASI_Hs01_00249431 predicted 240
7 SASI_Hs01_00249432 predicted 179
8 SASI_Hs01_00249433 predicted 207
9 SASI_Hs01_00249434 predicted 209
10 SASI_Hs01_00249435 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264665 predicted 322
2 SASI_Mm01_00264666 predicted 288
3 SASI_Mm02_00428185 predicted 286
4 SASI_Mm01_00264667 predicted 895
5 SASI_Mm01_00264668 predicted 442
6 SASI_Mm01_00264669 predicted 492
7 SASI_Mm01_00264671 predicted 843
8 SASI_Mm01_00264672 predicted 607
9 SASI_Mm01_00264673 predicted 656
10 SASI_Mm01_00264674 predicted 595
11 SASI_Mm01_00264670 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440894 predicted 321
2 SASI_Mm02_00440895 predicted 319
3 SASI_Mm02_00440896 predicted 316
4 SASI_Mm02_00440897 predicted 282
5 SASI_Mm02_00440898 predicted 286
6 SASI_Mm02_00440899 predicted 276
7 SASI_Mm02_00440900 predicted 315
8 SASI_Mm02_00440901 predicted 321
9 SASI_Mm02_00440902 predicted 303
10 SASI_Mm02_00440903 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136180
VALIDATED
HSBP1L1 MISSION shRNA Bacterial Glycerol Stock
heat shock factor binding protein 1-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-327s21c1
Sequence:CCGGTGGTGCAAGCTGGCATTGAAACTCGAGTTTCAATGCCAGCTTGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-285s21c1
Sequence:CCGGGAAATCGCATTGAGGACTTACCTCGAGGTAAGTCCTCAATGCGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-361s21c1
Sequence:CCGGACAAATGCTGAAGACCTAACTCTCGAGAGTTAGGTCTTCAGCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136180.1-307s21c1
Sequence:CCGGGAAGAATGTCAAGGACTTAATCTCGAGATTAAGTCCTTGACATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-242s21c1
Sequence:CCGGCAAGCTCTGACGGCAACATTACTCGAGTAATGTTGCCGTCAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-458s21c1
Sequence:CCGGATCCAACAGGATTCGTCTTTCCTCGAGGAAAGACGAATCCTGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-269s21c1
Sequence:CCGGAGAATGGAAGAAATGGGAAATCTCGAGATTTCCCATTTCTTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-406s21c1
Sequence:CCGGGGGCCTCTACAGAAGTCATTACTCGAGTAATGACTTCTGTAGAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136180
VALIDATED
HSBP1L1 MISSION shRNA shRNA Plasmid DNA
heat shock factor binding protein 1-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-327s21c1
Sequence:CCGGTGGTGCAAGCTGGCATTGAAACTCGAGTTTCAATGCCAGCTTGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-285s21c1
Sequence:CCGGGAAATCGCATTGAGGACTTACCTCGAGGTAAGTCCTCAATGCGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-361s21c1
Sequence:CCGGACAAATGCTGAAGACCTAACTCTCGAGAGTTAGGTCTTCAGCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136180.1-307s21c1
Sequence:CCGGGAAGAATGTCAAGGACTTAATCTCGAGATTAAGTCCTTGACATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-242s21c1
Sequence:CCGGCAAGCTCTGACGGCAACATTACTCGAGTAATGTTGCCGTCAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-458s21c1
Sequence:CCGGATCCAACAGGATTCGTCTTTCCTCGAGGAAAGACGAATCCTGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-269s21c1
Sequence:CCGGAGAATGGAAGAAATGGGAAATCTCGAGATTTCCCATTTCTTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-406s21c1
Sequence:CCGGGGGCCTCTACAGAAGTCATTACTCGAGTAATGACTTCTGTAGAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136180
VALIDATED
HSBP1L1 MISSION shRNA Lentiviral Transduction Particles
heat shock factor binding protein 1-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-327s21c1
Sequence:CCGGTGGTGCAAGCTGGCATTGAAACTCGAGTTTCAATGCCAGCTTGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-285s21c1
Sequence:CCGGGAAATCGCATTGAGGACTTACCTCGAGGTAAGTCCTCAATGCGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-361s21c1
Sequence:CCGGACAAATGCTGAAGACCTAACTCTCGAGAGTTAGGTCTTCAGCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136180.1-307s21c1
Sequence:CCGGGAAGAATGTCAAGGACTTAATCTCGAGATTAAGTCCTTGACATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-242s21c1
Sequence:CCGGCAAGCTCTGACGGCAACATTACTCGAGTAATGTTGCCGTCAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-458s21c1
Sequence:CCGGATCCAACAGGATTCGTCTTTCCTCGAGGAAAGACGAATCCTGTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-269s21c1
Sequence:CCGGAGAATGGAAGAAATGGGAAATCTCGAGATTTCCCATTTCTTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136180.1-406s21c1
Sequence:CCGGGGGCCTCTACAGAAGTCATTACTCGAGTAATGACTTCTGTAGAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136181
HSBP1L1 MISSION shRNA Bacterial Glycerol Stock
heat shock factor binding protein 1-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-300s21c1
Sequence:CCGGTCTAGAGGTTGAAGAACATTTCTCGAGAAATGTTCTTCAACCTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-322s21c1
Sequence:CCGGCAAGCTCTGACTACAACATTACTCGAGTAATGTTGTAGTCAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136181.1-900s21c1
Sequence:CCGGAGAATGCACTCACTCTATTAGCTCGAGCTAATAGAGTGAGTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-443s21c1
Sequence:CCGGCAGCGACCTGAAGATGTTAAACTCGAGTTTAACATCTTCAGGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-367s21c1
Sequence:CCGGAGTCGCATCGAGGACTTACAGCTCGAGCTGTAAGTCCTCGATGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136181
HSBP1L1 MISSION shRNA shRNA Plasmid DNA
heat shock factor binding protein 1-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-300s21c1
Sequence:CCGGTCTAGAGGTTGAAGAACATTTCTCGAGAAATGTTCTTCAACCTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-322s21c1
Sequence:CCGGCAAGCTCTGACTACAACATTACTCGAGTAATGTTGTAGTCAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136181.1-900s21c1
Sequence:CCGGAGAATGCACTCACTCTATTAGCTCGAGCTAATAGAGTGAGTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-443s21c1
Sequence:CCGGCAGCGACCTGAAGATGTTAAACTCGAGTTTAACATCTTCAGGTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-367s21c1
Sequence:CCGGAGTCGCATCGAGGACTTACAGCTCGAGCTGTAAGTCCTCGATGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136181
HSBP1L1 MISSION shRNA Lentiviral Transduction Particles
heat shock factor binding protein 1-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-300s21c1
Sequence:CCGGTCTAGAGGTTGAAGAACATTTCTCGAGAAATGTTCTTCAACCTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-322s21c1
Sequence:CCGGCAAGCTCTGACTACAACATTACTCGAGTAATGTTGTAGTCAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136181.1-900s21c1
Sequence:CCGGAGAATGCACTCACTCTATTAGCTCGAGCTAATAGAGTGAGTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-443s21c1
Sequence:CCGGCAGCGACCTGAAGATGTTAAACTCGAGTTTAACATCTTCAGGTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136181.1-367s21c1
Sequence:CCGGAGTCGCATCGAGGACTTACAGCTCGAGCTGTAAGTCCTCGATGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)