EMAIL THIS PAGE TO A FRIEND

HSCB

HscB mitochondrial iron-sulfur cluster co-chaperone

50 Gene Product Result for
Synonyms: DNAJC20 HSC20 JAC1 dJ366L4.2
UniProtKB ID: Q8IWL3, Q9BWS7
Gene ID:
Mouse(100900) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
Rat(360826) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
chicken(768938) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
domestic cat(101086094) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
cow(786040) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
dog(477531) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
domestic guinea pig(100720290) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
naked mole-rat(101722394) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
sheep(101106463) HscB iron-sulfur cluster co-chaperone homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172002 Rosetta Predictions human pricing
NM_001108340 Rosetta Predictions rat pricing
NM_153571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367763 predicted 333
2 SASI_Hs01_00063596 predicted 402
3 SASI_Hs02_00367764 predicted 332
4 SASI_Hs01_00063598 predicted 448
5 SASI_Hs01_00063599 predicted 270
6 SASI_Hs01_00063600 predicted 266
7 SASI_Hs01_00063601 predicted 513
8 SASI_Hs01_00063602 predicted 269
9 SASI_Hs01_00063603 predicted 454
10 SASI_Hs01_00063604 predicted 459
11 SASI_Hs01_00063597 predicted 515
12 SASI_Hs01_00063605 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237699 predicted 316
2 SASI_Rn02_00237700 predicted 430
3 SASI_Rn02_00237701 predicted 508
4 SASI_Rn02_00237702 predicted 229
5 SASI_Rn02_00237703 predicted 324
6 SASI_Rn02_00237704 predicted 351
7 SASI_Rn02_00237705 predicted 347
8 SASI_Rn02_00237706 predicted 259
9 SASI_Rn02_00237707 predicted 244
10 SASI_Rn02_00237708 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199351 predicted 372
2 SASI_Mm01_00199352 predicted 313
3 SASI_Mm01_00199353 predicted 311
4 SASI_Mm01_00199354 predicted 378
5 SASI_Mm01_00199356 predicted 373
6 SASI_Mm01_00199357 predicted 409
7 SASI_Mm01_00199358 predicted 415
8 SASI_Mm02_00343376 predicted 253
9 SASI_Mm01_00199359 predicted 366
10 SASI_Mm01_00199360 predicted 475
11 SASI_Mm01_00199355 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172002
VALIDATED
HSCB MISSION shRNA Bacterial Glycerol Stock
HscB mitochondrial iron-sulfur cluster co-chaperone
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-286s21c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-474s21c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-576s21c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-448s21c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-324s1c1
Sequence:CCGGGATTTCTTCAGCCAGAGGTCTCTCGAGAGACCTCTGGCTGAAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-474s1c1
Sequence:CCGGGATTATGAAATGGACAGGCAACTCGAGTTGCCTGTCCATTTCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-451s1c1
Sequence:CCGGGAATAGAGATTCCTGAAAGGACTCGAGTCCTTTCAGGAATCTCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-447s1c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-422s1c1
Sequence:CCGGCAGAGGACTGTACCTTCTAAACTCGAGTTTAGAAGGTACAGTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-549s1c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-538s1c1
Sequence:CCGGCTGAAAGTGAAGCTGCCATGACTCGAGTCATGGCAGCTTCACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-421s1c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-233s1c1
Sequence:CCGGCTTCAGCCTTATGGACTGCAACTCGAGTTGCAGTCCATAAGGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-259s1c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-263s1c1
Sequence:CCGGCAGAGTTGATACAGCGAAGCTCTCGAGAGCTTCGCTGTATCAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172002
VALIDATED
HSCB MISSION shRNA shRNA Plasmid DNA
HscB mitochondrial iron-sulfur cluster co-chaperone
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-286s21c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-474s21c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-576s21c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-448s21c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-324s1c1
Sequence:CCGGGATTTCTTCAGCCAGAGGTCTCTCGAGAGACCTCTGGCTGAAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-474s1c1
Sequence:CCGGGATTATGAAATGGACAGGCAACTCGAGTTGCCTGTCCATTTCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-451s1c1
Sequence:CCGGGAATAGAGATTCCTGAAAGGACTCGAGTCCTTTCAGGAATCTCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-447s1c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-422s1c1
Sequence:CCGGCAGAGGACTGTACCTTCTAAACTCGAGTTTAGAAGGTACAGTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-549s1c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-538s1c1
Sequence:CCGGCTGAAAGTGAAGCTGCCATGACTCGAGTCATGGCAGCTTCACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-421s1c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-233s1c1
Sequence:CCGGCTTCAGCCTTATGGACTGCAACTCGAGTTGCAGTCCATAAGGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-259s1c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-263s1c1
Sequence:CCGGCAGAGTTGATACAGCGAAGCTCTCGAGAGCTTCGCTGTATCAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172002
VALIDATED
HSCB MISSION shRNA Lentiviral Transduction Particles
HscB mitochondrial iron-sulfur cluster co-chaperone
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-286s21c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-474s21c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-576s21c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172002.3-448s21c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-324s1c1
Sequence:CCGGGATTTCTTCAGCCAGAGGTCTCTCGAGAGACCTCTGGCTGAAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-474s1c1
Sequence:CCGGGATTATGAAATGGACAGGCAACTCGAGTTGCCTGTCCATTTCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-451s1c1
Sequence:CCGGGAATAGAGATTCCTGAAAGGACTCGAGTCCTTTCAGGAATCTCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-447s1c1
Sequence:CCGGCATGGAATAGAGATTCCTGAACTCGAGTTCAGGAATCTCTATTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-422s1c1
Sequence:CCGGCAGAGGACTGTACCTTCTAAACTCGAGTTTAGAAGGTACAGTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-549s1c1
Sequence:CCGGGCTGCCATGAAAGAGATTGAACTCGAGTTCAATCTCTTTCATGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-538s1c1
Sequence:CCGGCTGAAAGTGAAGCTGCCATGACTCGAGTCATGGCAGCTTCACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_172002.2-421s1c1
Sequence:CCGGGCAGAGGACTGTACCTTCTAACTCGAGTTAGAAGGTACAGTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-233s1c1
Sequence:CCGGCTTCAGCCTTATGGACTGCAACTCGAGTTGCAGTCCATAAGGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_172002.2-259s1c1
Sequence:CCGGCCTTCAGAGTTGATACAGCGACTCGAGTCGCTGTATCAACTCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172002.2-263s1c1
Sequence:CCGGCAGAGTTGATACAGCGAAGCTCTCGAGAGCTTCGCTGTATCAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153571
VALIDATED
HSCB MISSION shRNA Bacterial Glycerol Stock
HscB mitochondrial iron-sulfur cluster co-chaperone
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-411s21c1
Sequence:CCGGCCCTGACCAGAGGACTATATCCTCGAGGATATAGTCCTCTGGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-438s21c1
Sequence:CCGGAGCTCCAGGGAATAGAAATTCCTCGAGGAATTTCTATTCCCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-577s21c1
Sequence:CCGGAGCTAAACAGAAAGAATTTACCTCGAGGTAAATTCTTTCTGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-493s21c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-376s21c1
Sequence:CCGGCCTGGTGAATGATGCCTATAACTCGAGTTATAGGCATCATTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-442s1c1
Sequence:CCGGCCAGGGAATAGAAATTCCTGACTCGAGTCAGGAATTTCTATTCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-493s1c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153571
VALIDATED
HSCB MISSION shRNA shRNA Plasmid DNA
HscB mitochondrial iron-sulfur cluster co-chaperone
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-411s21c1
Sequence:CCGGCCCTGACCAGAGGACTATATCCTCGAGGATATAGTCCTCTGGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-438s21c1
Sequence:CCGGAGCTCCAGGGAATAGAAATTCCTCGAGGAATTTCTATTCCCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-577s21c1
Sequence:CCGGAGCTAAACAGAAAGAATTTACCTCGAGGTAAATTCTTTCTGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-493s21c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-376s21c1
Sequence:CCGGCCTGGTGAATGATGCCTATAACTCGAGTTATAGGCATCATTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-442s1c1
Sequence:CCGGCCAGGGAATAGAAATTCCTGACTCGAGTCAGGAATTTCTATTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-493s1c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153571
VALIDATED
HSCB MISSION shRNA Lentiviral Transduction Particles
HscB mitochondrial iron-sulfur cluster co-chaperone
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-411s21c1
Sequence:CCGGCCCTGACCAGAGGACTATATCCTCGAGGATATAGTCCTCTGGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-438s21c1
Sequence:CCGGAGCTCCAGGGAATAGAAATTCCTCGAGGAATTTCTATTCCCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-577s21c1
Sequence:CCGGAGCTAAACAGAAAGAATTTACCTCGAGGTAAATTCTTTCTGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-493s21c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153571.1-376s21c1
Sequence:CCGGCCTGGTGAATGATGCCTATAACTCGAGTTATAGGCATCATTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-442s1c1
Sequence:CCGGCCAGGGAATAGAAATTCCTGACTCGAGTCAGGAATTTCTATTCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153571.1-493s1c1
Sequence:CCGGCCTTGTGGAAATCATGGAAATCTCGAGATTTCCATGATTTCCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)