EMAIL THIS PAGE TO A FRIEND

HSD11B1

hydroxysteroid (11-beta) dehydrogenase 1

110 Gene Product Result for
Synonyms: 11-DH 11-beta-HSD1 CORTRD2 HDL HSD11 HSD11B HSD11L SDR26C1
UniProtKB ID: P28845, B2R9Z1, D3DT89
Gene ID:
Human(3290) Summary: The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
Mouse(15483) hydroxysteroid 11-beta dehydrogenase 1
Rat(25116) hydroxysteroid 11-beta dehydrogenase 1
chicken(419861) hydroxysteroid (11-beta) dehydrogenase 1
cow(282589) hydroxysteroid (11-beta) dehydrogenase 1
domestic cat(100529248) hydroxysteroid (11-beta) dehydrogenase 1
dog(449023) hydroxysteroid (11-beta) dehydrogenase 1
sheep(443409) hydroxysteroid (11-beta) dehydrogenase 1
domestic guinea pig(100135542) hydroxysteroid 11-beta dehydrogenase 1
naked mole-rat(101716800) hydroxysteroid (11-beta) dehydrogenase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
50510 18β-Glycyrrhetinic acid purum, ≥97.0% (T) human, rat pricing
G10105 18β-Glycyrrhetinic acid 97% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181755 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043531 MISSION® esiRNA esiRNA human HSD11B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005525 Rosetta Predictions human pricing
NM_181755 Rosetta Predictions human pricing
NM_017080 Rosetta Predictions rat pricing
NM_001044751 Rosetta Predictions mouse pricing
NM_008288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173756 predicted 522
2 SASI_Hs01_00173757 predicted 733
3 SASI_Hs02_00339743 predicted 729
4 SASI_Hs01_00173758 predicted 422
5 SASI_Hs01_00173759 predicted 456
6 SASI_Hs02_00339744 predicted 921
7 SASI_Hs01_00173760 predicted 933
8 SASI_Hs01_00173761 predicted 910
9 SASI_Hs01_00173762 predicted 770
10 SASI_Hs01_00173763 predicted 934
11 SASI_Hs01_00173764 predicted 818
12 SASI_Hs01_00173765 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222423 predicted 535
2 SASI_Hs01_00222424 predicted 735
3 SASI_Hs02_00370358 predicted 739
4 SASI_Hs01_00222425 predicted 433
5 SASI_Hs01_00222426 predicted 465
6 SASI_Hs02_00370359 predicted 935
7 SASI_Hs01_00222427 predicted 937
8 SASI_Hs01_00222428 predicted 923
9 SASI_Hs01_00222429 predicted 782
10 SASI_Hs01_00222430 predicted 949
11 SASI_Hs01_00222431 predicted 830
12 SASI_Hs01_00222432 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084925 predicted 691
2 SASI_Rn01_00084926 predicted 619
3 SASI_Rn01_00084927 predicted 378
4 SASI_Rn01_00084928 predicted 978
5 SASI_Rn01_00084929 predicted 711
6 SASI_Rn01_00084930 predicted 734
7 SASI_Rn01_00084931 predicted 378
8 SASI_Rn01_00084932 predicted 727
9 SASI_Rn01_00084933 predicted 597
10 SASI_Rn02_00261293 predicted 447
11 SASI_Rn01_00084934 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291444 predicted 951
2 SASI_Mm02_00291445 predicted 768
3 SASI_Mm02_00291446 predicted 955
4 SASI_Mm02_00291447 predicted 365
5 SASI_Mm02_00291448 predicted 381
6 SASI_Mm02_00291449 predicted 377
7 SASI_Mm02_00291450 predicted 677
8 SASI_Mm02_00291451 predicted 770
9 SASI_Mm02_00291452 predicted 378
10 SASI_Mm02_00291453 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313559 predicted 978
2 SASI_Mm02_00313560 predicted 792
3 SASI_Mm01_00195282 predicted 984
4 SASI_Mm01_00195283 predicted 390
5 SASI_Mm01_00195284 predicted 406
6 SASI_Mm01_00195285 predicted 408
7 SASI_Mm01_00195286 predicted 702
8 SASI_Mm01_00195279 predicted 796
9 SASI_Mm01_00195287 predicted 403
10 SASI_Mm01_00195288 predicted 1072
11 SASI_Mm01_00195280 predicted 266
12 SASI_Mm01_00195281 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008288
HSD11B1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (11-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-399s1c1
Sequence:CCGGGCACTATGGAAGACATGACATCTCGAGATGTCATGTCTTCCATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-255s1c1
Sequence:CCGGGCAAAGGGATTGGAAGAGAAACTCGAGTTTCTCTTCCAATCCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-895s1c1
Sequence:CCGGGTACTATGACAAATTGCCTTTCTCGAGAAAGGCAATTTGTCATAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-680s1c1
Sequence:CCGGGCAAGCAAGTTTGCTCTGGATCTCGAGATCCAGAGCAAACTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-712s1c1
Sequence:CCGGCACCATTAGAACAGAACTCTACTCGAGTAGAGTTCTGTTCTAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008288
HSD11B1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (11-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-399s1c1
Sequence:CCGGGCACTATGGAAGACATGACATCTCGAGATGTCATGTCTTCCATAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-255s1c1
Sequence:CCGGGCAAAGGGATTGGAAGAGAAACTCGAGTTTCTCTTCCAATCCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-895s1c1
Sequence:CCGGGTACTATGACAAATTGCCTTTCTCGAGAAAGGCAATTTGTCATAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-680s1c1
Sequence:CCGGGCAAGCAAGTTTGCTCTGGATCTCGAGATCCAGAGCAAACTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-712s1c1
Sequence:CCGGCACCATTAGAACAGAACTCTACTCGAGTAGAGTTCTGTTCTAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008288
HSD11B1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (11-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-399s1c1
Sequence:CCGGGCACTATGGAAGACATGACATCTCGAGATGTCATGTCTTCCATAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-255s1c1
Sequence:CCGGGCAAAGGGATTGGAAGAGAAACTCGAGTTTCTCTTCCAATCCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-895s1c1
Sequence:CCGGGTACTATGACAAATTGCCTTTCTCGAGAAAGGCAATTTGTCATAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-680s1c1
Sequence:CCGGGCAAGCAAGTTTGCTCTGGATCTCGAGATCCAGAGCAAACTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008288.1-712s1c1
Sequence:CCGGCACCATTAGAACAGAACTCTACTCGAGTAGAGTTCTGTTCTAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181755
HSD11B1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (11-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-691s1c1
Sequence:CCGGCCTCCATCAGAAAGGAATATTCTCGAGAATATTCCTTTCTGATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-200s1c1
Sequence:CCGGGCTCCAAGGAAAGAAAGTGATCTCGAGATCACTTTCTTTCCTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-472s1c1
Sequence:CCGGCCAACACTTCTTTGAATCTTTCTCGAGAAAGATTCAAAGAAGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-952s1c1
Sequence:CCGGCGAGCTATAATATGGACAGATCTCGAGATCTGTCCATATTATAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-402s1c1
Sequence:CCGGGCAGAGCAATTTGTTGCCCAACTCGAGTTGGGCAACAAATTGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-243s21c1
Sequence:CCGGATCGGAAGAGAGATGGCTTATCTCGAGATAAGCCATCTCTCTTCCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1216s21c1
Sequence:CCGGATAGGTATAATTACCAGATAGCTCGAGCTATCTGGTAATTATACCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-439s21c1
Sequence:CCGGGAGGACTAGACATGCTCATTCCTCGAGGAATGAGCATGTCTAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1123s21c1
Sequence:CCGGGAAGGAGTTCCTCTAACATTTCTCGAGAAATGTTAGAGGAACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181755
HSD11B1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (11-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-691s1c1
Sequence:CCGGCCTCCATCAGAAAGGAATATTCTCGAGAATATTCCTTTCTGATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-200s1c1
Sequence:CCGGGCTCCAAGGAAAGAAAGTGATCTCGAGATCACTTTCTTTCCTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-472s1c1
Sequence:CCGGCCAACACTTCTTTGAATCTTTCTCGAGAAAGATTCAAAGAAGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-952s1c1
Sequence:CCGGCGAGCTATAATATGGACAGATCTCGAGATCTGTCCATATTATAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-402s1c1
Sequence:CCGGGCAGAGCAATTTGTTGCCCAACTCGAGTTGGGCAACAAATTGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-243s21c1
Sequence:CCGGATCGGAAGAGAGATGGCTTATCTCGAGATAAGCCATCTCTCTTCCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1216s21c1
Sequence:CCGGATAGGTATAATTACCAGATAGCTCGAGCTATCTGGTAATTATACCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-439s21c1
Sequence:CCGGGAGGACTAGACATGCTCATTCCTCGAGGAATGAGCATGTCTAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1123s21c1
Sequence:CCGGGAAGGAGTTCCTCTAACATTTCTCGAGAAATGTTAGAGGAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181755
HSD11B1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (11-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-691s1c1
Sequence:CCGGCCTCCATCAGAAAGGAATATTCTCGAGAATATTCCTTTCTGATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-200s1c1
Sequence:CCGGGCTCCAAGGAAAGAAAGTGATCTCGAGATCACTTTCTTTCCTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-472s1c1
Sequence:CCGGCCAACACTTCTTTGAATCTTTCTCGAGAAAGATTCAAAGAAGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-952s1c1
Sequence:CCGGCGAGCTATAATATGGACAGATCTCGAGATCTGTCCATATTATAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181755.1-402s1c1
Sequence:CCGGGCAGAGCAATTTGTTGCCCAACTCGAGTTGGGCAACAAATTGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-243s21c1
Sequence:CCGGATCGGAAGAGAGATGGCTTATCTCGAGATAAGCCATCTCTCTTCCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1216s21c1
Sequence:CCGGATAGGTATAATTACCAGATAGCTCGAGCTATCTGGTAATTATACCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181755.1-439s21c1
Sequence:CCGGGAGGACTAGACATGCTCATTCCTCGAGGAATGAGCATGTCTAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181755.1-1123s21c1
Sequence:CCGGGAAGGAGTTCCTCTAACATTTCTCGAGAAATGTTAGAGGAACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)