EMAIL THIS PAGE TO A FRIEND

HSD11B1L

hydroxysteroid (11-beta) dehydrogenase 1-like

84 Gene Product Result for
Synonyms: 11-DH3 11-beta-HSD3 HSD3 SCDR10 SCDR10B SDR26C2
Gene ID:
Human(374875) Summary: This gene is a member of the hydroxysteroid dehydrogenase family. The encoded protein is similar to an enzyme that catalyzes the interconversion of inactive to active glucocorticoids (e.g. cortisone). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
sheep(101109443) hydroxysteroid (11-beta) dehydrogenase 1-like
chicken(408034) hydroxysteroid (11-beta) dehydrogenase 1-like
cow(404546) hydroxysteroid (11-beta) dehydrogenase 1-like
domestic cat(101092746) hydroxysteroid (11-beta) dehydrogenase 1-like
dog(485027) hydroxysteroid (11-beta) dehydrogenase 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198708 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140671 MISSION® esiRNA esiRNA human HSD11B1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198533 Rosetta Predictions human pricing
NM_198704 Rosetta Predictions human pricing
NM_198705 Rosetta Predictions human pricing
NM_198706 Rosetta Predictions human pricing
NM_198707 Rosetta Predictions human pricing
NM_198708 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372121 predicted 1402
2 SASI_Hs01_00118916 predicted 641
3 SASI_Hs02_00372122 predicted 291
4 SASI_Hs01_00118919 predicted 970
5 SASI_Hs01_00118920 predicted 1008
6 SASI_Hs01_00118921 predicted 840
7 SASI_Hs01_00118922 predicted 1289
8 SASI_Hs01_00118924 predicted 762
9 SASI_Hs01_00118925 predicted 660
10 SASI_Hs02_00372123 predicted 1454
11 SASI_Hs01_00118917 predicted 652
12 SASI_Hs01_00118918 predicted 1301
13 SASI_Hs01_00118923 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107122 predicted 1244
2 SASI_Hs02_00372283 predicted 809
3 SASI_Hs01_00107124 predicted 846
4 SASI_Hs01_00107125 predicted 680
5 SASI_Hs01_00107126 predicted 1127
6 SASI_Hs01_00107127 predicted 596
7 SASI_Hs01_00107128 predicted 499
8 SASI_Hs01_00107129 predicted 1241
9 SASI_Hs01_00107130 predicted 1290
10 SASI_Hs01_00107131 predicted 604
11 SASI_Hs01_00107123 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122948 predicted 1341
2 SASI_Hs01_00122950 predicted 298
3 SASI_Hs01_00122952 predicted 781
4 SASI_Hs01_00122954 predicted 937
5 SASI_Hs01_00122955 predicted 612
6 SASI_Hs02_00372284 predicted 1224
7 SASI_Hs01_00122956 predicted 531
8 SASI_Hs01_00122957 predicted 426
9 SASI_Hs02_00372285 predicted 537
10 SASI_Hs02_00372286 predicted 612
11 SASI_Hs01_00122949 predicted 422
12 SASI_Hs01_00122951 predicted 1234
13 SASI_Hs01_00122953 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148965 predicted 1537
2 SASI_Hs01_00148966 predicted 612
3 SASI_Hs01_00148967 predicted 257
4 SASI_Hs01_00148969 predicted 987
5 SASI_Hs01_00148970 predicted 1108
6 SASI_Hs01_00148971 predicted 1137
7 SASI_Hs01_00148972 predicted 811
8 SASI_Hs02_00372287 predicted 1427
9 SASI_Hs01_00148973 predicted 728
10 SASI_Hs01_00148974 predicted 626
11 SASI_Hs01_00148968 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063253 predicted 1495
2 SASI_Hs01_00063254 predicted 572
3 SASI_Hs01_00063256 predicted 940
4 SASI_Hs01_00063258 predicted 1097
5 SASI_Hs01_00063259 predicted 773
6 SASI_Hs02_00372288 predicted 1384
7 SASI_Hs01_00063260 predicted 695
8 SASI_Hs01_00063262 predicted 591
9 SASI_Hs02_00372289 predicted 699
10 SASI_Hs02_00372290 predicted 773
11 SASI_Hs01_00063255 predicted 1398
12 SASI_Hs01_00063257 predicted 1077
13 SASI_Hs01_00063261 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083240 predicted 1432
2 SASI_Hs01_00083242 predicted 869
3 SASI_Hs01_00083243 predicted 1029
4 SASI_Hs01_00083244 predicted 705
5 SASI_Hs01_00083245 predicted 1317
6 SASI_Hs01_00083246 predicted 618
7 SASI_Hs01_00083248 predicted 521
8 SASI_Hs02_00372291 predicted 1430
9 SASI_Hs02_00372292 predicted 630
10 SASI_Hs02_00372293 predicted 706
11 SASI_Hs01_00083241 predicted 1322
12 SASI_Hs01_00083247 predicted 1202
13 SASI_Hs01_00083249 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198708
HSD11B1L MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (11-beta) dehydrogenase 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1221s21c1
Sequence:CCGGATGACGTGACTGCTTCCATTTCTCGAGAAATGGAAGCAGTCACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1072s21c1
Sequence:CCGGCAGCCCAAGATGAAGTCATCACTCGAGTGATGACTTCATCTTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1006s21c1
Sequence:CCGGATGTTCCTCCCTCCAACTGTCCTCGAGGACAGTTGGAGGGAGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1308s21c1
Sequence:CCGGATCTCCTGCCTGCGCCTTTAACTCGAGTTAAAGGCGCAGGCAGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-926s1c1
Sequence:CCGGCTGGTTTATCCGCCAGGAGCTCTCGAGAGCTCCTGGCGGATAAACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-704s1c1
Sequence:CCGGGCAGGACGTGAACGTGGCCATCTCGAGATGGCCACGTTCACGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-560s1c1
Sequence:CCGGGCCCAGCCTGACGGACAGCAACTCGAGTTGCTGTCCGTCAGGCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-623s1c1
Sequence:CCGGCACGTCGTTCTCCACTCCCTACTCGAGTAGGGAGTGGAGAACGACGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-860s1c1
Sequence:CCGGCGTCTTCTACCCGTGGCGTTTCTCGAGAAACGCCACGGGTAGAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198708
HSD11B1L MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (11-beta) dehydrogenase 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1221s21c1
Sequence:CCGGATGACGTGACTGCTTCCATTTCTCGAGAAATGGAAGCAGTCACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1072s21c1
Sequence:CCGGCAGCCCAAGATGAAGTCATCACTCGAGTGATGACTTCATCTTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1006s21c1
Sequence:CCGGATGTTCCTCCCTCCAACTGTCCTCGAGGACAGTTGGAGGGAGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1308s21c1
Sequence:CCGGATCTCCTGCCTGCGCCTTTAACTCGAGTTAAAGGCGCAGGCAGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-926s1c1
Sequence:CCGGCTGGTTTATCCGCCAGGAGCTCTCGAGAGCTCCTGGCGGATAAACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-704s1c1
Sequence:CCGGGCAGGACGTGAACGTGGCCATCTCGAGATGGCCACGTTCACGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-560s1c1
Sequence:CCGGGCCCAGCCTGACGGACAGCAACTCGAGTTGCTGTCCGTCAGGCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-623s1c1
Sequence:CCGGCACGTCGTTCTCCACTCCCTACTCGAGTAGGGAGTGGAGAACGACGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-860s1c1
Sequence:CCGGCGTCTTCTACCCGTGGCGTTTCTCGAGAAACGCCACGGGTAGAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198708
HSD11B1L MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (11-beta) dehydrogenase 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1221s21c1
Sequence:CCGGATGACGTGACTGCTTCCATTTCTCGAGAAATGGAAGCAGTCACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1072s21c1
Sequence:CCGGCAGCCCAAGATGAAGTCATCACTCGAGTGATGACTTCATCTTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1006s21c1
Sequence:CCGGATGTTCCTCCCTCCAACTGTCCTCGAGGACAGTTGGAGGGAGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198708.1-1308s21c1
Sequence:CCGGATCTCCTGCCTGCGCCTTTAACTCGAGTTAAAGGCGCAGGCAGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-926s1c1
Sequence:CCGGCTGGTTTATCCGCCAGGAGCTCTCGAGAGCTCCTGGCGGATAAACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-704s1c1
Sequence:CCGGGCAGGACGTGAACGTGGCCATCTCGAGATGGCCACGTTCACGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-560s1c1
Sequence:CCGGGCCCAGCCTGACGGACAGCAACTCGAGTTGCTGTCCGTCAGGCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-623s1c1
Sequence:CCGGCACGTCGTTCTCCACTCCCTACTCGAGTAGGGAGTGGAGAACGACGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198708.1-860s1c1
Sequence:CCGGCGTCTTCTACCCGTGGCGTTTCTCGAGAAACGCCACGGGTAGAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)