EMAIL THIS PAGE TO A FRIEND

HSD11B2

hydroxysteroid (11-beta) dehydrogenase 2

92 Gene Product Result for
Synonyms: AME AME1 HSD11K HSD2 SDR9C3
Gene ID:
Human(3291) Summary: There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
Mouse(15484) hydroxysteroid 11-beta dehydrogenase 2
Rat(25117) hydroxysteroid 11-beta dehydrogenase 2
Zebrafish(334098) hydroxysteroid 11-beta dehydrogenase 2
cow(282434) hydroxysteroid (11-beta) dehydrogenase 2
Horse(100034124) hydroxysteroid (11-beta) dehydrogenase 2
domestic cat(100529249) hydroxysteroid (11-beta) dehydrogenase 2
dog(489758) hydroxysteroid (11-beta) dehydrogenase 2
chicken(100857283) hydroxysteroid (11-beta) dehydrogenase 2
Domestic Rabbit(100009531) hydroxysteroid (11-beta) dehydrogenase 2
domestic guinea pig(100733422) hydroxysteroid (11-beta) dehydrogenase 2
naked mole-rat(101712460) hydroxysteroid (11-beta) dehydrogenase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
50510 18β-Glycyrrhetinic acid purum, ≥97.0% (T) human, rat pricing
G10105 18β-Glycyrrhetinic acid 97% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015241 MISSION® esiRNA esiRNA targeting human HSD11B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000196 Rosetta Predictions human pricing
NM_017081 Rosetta Predictions rat pricing
NM_008289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220497 predicted 1548
2 SASI_Hs01_00220498 predicted 1650
3 SASI_Hs01_00220500 predicted 995
4 SASI_Hs01_00220501 predicted 1527
5 SASI_Hs01_00220504 predicted 920
6 SASI_Hs01_00220505 predicted 675
7 SASI_Hs02_00302057 predicted 831
8 SASI_Hs02_00302058 predicted 827
9 SASI_Hs02_00302059 predicted 895
10 SASI_Hs02_00302060 predicted 538
11 SASI_Hs01_00220499 predicted 610
12 SASI_Hs01_00220502 predicted 414
13 SASI_Hs01_00220503 predicted 398
14 SASI_Hs01_00220506 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065410 predicted 693
2 SASI_Rn01_00065411 predicted 833
3 SASI_Rn01_00065412 predicted 885
4 SASI_Rn01_00065413 predicted 1307
5 SASI_Rn01_00065414 predicted 668
6 SASI_Rn01_00065415 predicted 680
7 SASI_Rn01_00065416 predicted 1032
8 SASI_Rn01_00065417 predicted 1333
9 SASI_Rn01_00065418 predicted 1009
10 SASI_Rn01_00065419 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032193 predicted 544
2 SASI_Mm02_00313561 predicted 682
3 SASI_Mm01_00032195 predicted 397
4 SASI_Mm02_00313562 predicted 1594
5 SASI_Mm02_00313563 predicted 910
6 SASI_Mm01_00032199 predicted 831
7 SASI_Mm02_00313564 predicted 914
8 SASI_Mm02_00313565 predicted 634
9 SASI_Mm02_00313566 predicted 996
10 SASI_Mm02_00313567 predicted 1056
11 SASI_Mm01_00032194 predicted 269
12 SASI_Mm01_00032196 predicted 890
13 SASI_Mm01_00032197 predicted 348
14 SASI_Mm01_00032198 predicted 509
15 SASI_Mm01_00032200 predicted 932
16 SASI_Mm01_00032201 predicted 895
17 SASI_Mm01_00032202 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000196
VALIDATED
HSD11B2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (11-beta) dehydrogenase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-448s1c1
Sequence:CCGGCCACCGTATTGGAGTTGAACACTCGAGTGTTCAACTCCAATACGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1154s1c1
Sequence:CCGGCATGTACTTCATCCACTACTACTCGAGTAGTAGTGGATGAAGTACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-618s1c1
Sequence:CCGGGCAGGCCACAATGAAGTAGTTCTCGAGAACTACTTCATTGTGGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1004s1c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-530s1c1
Sequence:CCGGCCTGACCAAACCAGGAGACATCTCGAGATGTCTCCTGGTTTGGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000196.3-1736s21c1
Sequence:CCGGTGCTGCAATTGAGGGCTAAATCTCGAGATTTAGCCCTCAATTGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-1004s21c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-834s21c1
Sequence:CCGGGCGCTACTCATGGACACATTCCTCGAGGAATGTGTCCATGAGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-674s21c1
Sequence:CCGGTAGCTGCATGGAGGTGAATTTCTCGAGAAATTCACCTCCATGCAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-783s21c1
Sequence:CCGGGACATGCCATATCCGTGCTTGCTCGAGCAAGCACGGATATGGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000196
VALIDATED
HSD11B2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (11-beta) dehydrogenase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-448s1c1
Sequence:CCGGCCACCGTATTGGAGTTGAACACTCGAGTGTTCAACTCCAATACGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1154s1c1
Sequence:CCGGCATGTACTTCATCCACTACTACTCGAGTAGTAGTGGATGAAGTACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-618s1c1
Sequence:CCGGGCAGGCCACAATGAAGTAGTTCTCGAGAACTACTTCATTGTGGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1004s1c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-530s1c1
Sequence:CCGGCCTGACCAAACCAGGAGACATCTCGAGATGTCTCCTGGTTTGGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000196.3-1736s21c1
Sequence:CCGGTGCTGCAATTGAGGGCTAAATCTCGAGATTTAGCCCTCAATTGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-1004s21c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-834s21c1
Sequence:CCGGGCGCTACTCATGGACACATTCCTCGAGGAATGTGTCCATGAGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-674s21c1
Sequence:CCGGTAGCTGCATGGAGGTGAATTTCTCGAGAAATTCACCTCCATGCAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-783s21c1
Sequence:CCGGGACATGCCATATCCGTGCTTGCTCGAGCAAGCACGGATATGGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000196
VALIDATED
HSD11B2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (11-beta) dehydrogenase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-448s1c1
Sequence:CCGGCCACCGTATTGGAGTTGAACACTCGAGTGTTCAACTCCAATACGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1154s1c1
Sequence:CCGGCATGTACTTCATCCACTACTACTCGAGTAGTAGTGGATGAAGTACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-618s1c1
Sequence:CCGGGCAGGCCACAATGAAGTAGTTCTCGAGAACTACTTCATTGTGGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-1004s1c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000196.2-530s1c1
Sequence:CCGGCCTGACCAAACCAGGAGACATCTCGAGATGTCTCCTGGTTTGGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000196.3-1736s21c1
Sequence:CCGGTGCTGCAATTGAGGGCTAAATCTCGAGATTTAGCCCTCAATTGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-1004s21c1
Sequence:CCGGCAAGGACTACATCGAGCACTTCTCGAGAAGTGCTCGATGTAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-834s21c1
Sequence:CCGGGCGCTACTCATGGACACATTCCTCGAGGAATGTGTCCATGAGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-674s21c1
Sequence:CCGGTAGCTGCATGGAGGTGAATTTCTCGAGAAATTCACCTCCATGCAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000196.3-783s21c1
Sequence:CCGGGACATGCCATATCCGTGCTTGCTCGAGCAAGCACGGATATGGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008289
HSD11B2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (11-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-1097s1c1
Sequence:CCGGCCTACAGAACTTCTTTATCAACTCGAGTTGATAAAGAAGTTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-435s1c1
Sequence:CCGGGCAGAGGACATCAGCCGTGTTCTCGAGAACACGGCTGATGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-305s1c1
Sequence:CCGGAGCTAAGAAACTGGATGCCATCTCGAGATGGCATCCAGTTTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c1
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c2
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008289
HSD11B2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (11-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-1097s1c1
Sequence:CCGGCCTACAGAACTTCTTTATCAACTCGAGTTGATAAAGAAGTTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-435s1c1
Sequence:CCGGGCAGAGGACATCAGCCGTGTTCTCGAGAACACGGCTGATGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-305s1c1
Sequence:CCGGAGCTAAGAAACTGGATGCCATCTCGAGATGGCATCCAGTTTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c1
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c2
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008289
HSD11B2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (11-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-1097s1c1
Sequence:CCGGCCTACAGAACTTCTTTATCAACTCGAGTTGATAAAGAAGTTCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-435s1c1
Sequence:CCGGGCAGAGGACATCAGCCGTGTTCTCGAGAACACGGCTGATGTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-305s1c1
Sequence:CCGGAGCTAAGAAACTGGATGCCATCTCGAGATGGCATCCAGTTTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c1
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008289.1-957s1c2
Sequence:CCGGCCTGACCTTAGCCCAGTTGTACTCGAGTACAACTGGGCTAAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)