EMAIL THIS PAGE TO A FRIEND

HSD17B10

hydroxysteroid (17-beta) dehydrogenase 10

69 Gene Product Result for
Synonyms: 17b-HSD10 ABAD CAMR DUPXp11.22 ERAB HADH2 HCD2 MHBD MRPP2 MRX17 MRX31 MRXS10 SCHAD SDR5C1
UniProtKB ID: Q99714, Q5H927, Q8TCV9, Q96HD5
Gene ID:
Human(3028) Summary: This gene encodes 3-hydroxyacyl-CoA dehydrogenase type II, a member of the short-chain dehydrogenase/reductase superfamily. The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids, alcohols, and steroids. The protein has been implicated in the development of Alzheimer's disease, and mutations in the gene are the cause of 2-methyl-3-hydroxybutyryl-CoA dehydrogenase deficiency (MHBD). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Mouse(15108) hydroxysteroid (17-beta) dehydrogenase 10
Rat(63864) hydroxysteroid (17-beta) dehydrogenase 10
Zebrafish(450078) hydroxysteroid (17-beta) dehydrogenase 10
chicken(425758) hydroxysteroid (17-beta) dehydrogenase 10
cow(281809) hydroxysteroid (17-beta) dehydrogenase 10
domestic cat(101090672) hydroxysteroid (17-beta) dehydrogenase 10
dog(480930) hydroxysteroid (17-beta) dehydrogenase 10
domestic guinea pig(100718814) hydroxysteroid (17-beta) dehydrogenase 10
naked mole-rat(101712281) hydroxysteroid (17-beta) dehydrogenase 10
sheep(101119880) hydroxysteroid (17-beta) dehydrogenase 10
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037811 Rosetta Predictions human pricing
NM_004493 Rosetta Predictions human pricing
NM_031682 Rosetta Predictions rat pricing
NM_016763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067745 predicted 313
2 SASI_Hs02_00308376 predicted 226
3 SASI_Hs01_00067746 predicted 370
4 SASI_Hs01_00067747 predicted 336
5 SASI_Hs02_00308377 predicted 341
6 SASI_Hs01_00067748 predicted 305
7 SASI_Hs01_00067749 predicted 349
8 SASI_Hs01_00067750 predicted 206
9 SASI_Hs01_00067751 predicted 284
10 SASI_Hs01_00067752 predicted 269
11 SASI_Hs01_00067744 predicted 286
12 SASI_Hs01_00067753 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144680 predicted 311
2 SASI_Hs02_00337738 predicted 222
3 SASI_Hs01_00144681 predicted 372
4 SASI_Hs01_00144682 predicted 339
5 SASI_Hs02_00337739 predicted 347
6 SASI_Hs01_00144683 predicted 302
7 SASI_Hs01_00144684 predicted 347
8 SASI_Hs01_00144685 predicted 213
9 SASI_Hs01_00144686 predicted 278
10 SASI_Hs01_00144687 predicted 275
11 SASI_Hs01_00144679 predicted 279
12 SASI_Hs01_00144688 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075935 predicted 385
2 SASI_Rn01_00075936 predicted 289
3 SASI_Rn01_00075937 predicted 258
4 SASI_Rn01_00075938 predicted 563
5 SASI_Rn01_00075939 predicted 442
6 SASI_Rn01_00075940 predicted 349
7 SASI_Rn01_00075941 predicted 264
8 SASI_Rn01_00075942 predicted 443
9 SASI_Rn01_00075943 predicted 301
10 SASI_Rn01_00075944 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323514 predicted 342
2 SASI_Mm01_00037153 predicted 356
3 SASI_Mm01_00037155 predicted 440
4 SASI_Mm01_00037156 predicted 284
5 SASI_Mm01_00037157 predicted 229
6 SASI_Mm01_00037158 predicted 383
7 SASI_Mm01_00037159 predicted 272
8 SASI_Mm02_00323515 predicted 202
9 SASI_Mm01_00037161 predicted 648
10 SASI_Mm01_00037162 predicted 476
11 SASI_Mm01_00037154 predicted 262
12 SASI_Mm01_00037160 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004493
VALIDATED
HSD17B10 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-751s21c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-320s21c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-352s21c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-185s1c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-348s1c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-369s1c1
Sequence:CCGGCCAGCGAGTTCTTGATGTGAACTCGAGTTCACATCAAGAACTCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-316s1c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-747s1c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-189s21c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004493
VALIDATED
HSD17B10 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-751s21c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-320s21c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-352s21c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-185s1c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-348s1c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-369s1c1
Sequence:CCGGCCAGCGAGTTCTTGATGTGAACTCGAGTTCACATCAAGAACTCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-316s1c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-747s1c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-189s21c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004493
VALIDATED
HSD17B10 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-751s21c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-320s21c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-352s21c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-185s1c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-348s1c1
Sequence:CCGGGACCCATACCTTGGAAGACTTCTCGAGAAGTCTTCCAAGGTATGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-369s1c1
Sequence:CCGGCCAGCGAGTTCTTGATGTGAACTCGAGTTCACATCAAGAACTCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-316s1c1
Sequence:CCGGGCTAGCAAGACGTACAACTTACTCGAGTAAGTTGTACGTCTTGCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004493.1-747s1c1
Sequence:CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004493.2-189s21c1
Sequence:CCGGAGTTAGGAAACAACTGCGTTTCTCGAGAAACGCAGTTGTTTCCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016763
VALIDATED
HSD17B10 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-813s1c1
Sequence:CCGGGCTCATCTGGTACAGACCATACTCGAGTATGGTCTGTACCAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-272s1c1
Sequence:CCGGGTTAGGAGAAAGCTGCATATTCTCGAGAATATGCAGCTTTCTCCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-375s1c1
Sequence:CCGGGCTGTCAACTGTGCAGGTATTCTCGAGAATACCTGCACAGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-459s1c1
Sequence:CCGGCGGGTTATCAATGTGAATCTTCTCGAGAAGATTCACATTGATAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-737s1c1
Sequence:CCGGCCTTCCAGAGAAAGTGCGAAACTCGAGTTTCGCACTTTCTCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016763
VALIDATED
HSD17B10 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-813s1c1
Sequence:CCGGGCTCATCTGGTACAGACCATACTCGAGTATGGTCTGTACCAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-272s1c1
Sequence:CCGGGTTAGGAGAAAGCTGCATATTCTCGAGAATATGCAGCTTTCTCCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-375s1c1
Sequence:CCGGGCTGTCAACTGTGCAGGTATTCTCGAGAATACCTGCACAGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-459s1c1
Sequence:CCGGCGGGTTATCAATGTGAATCTTCTCGAGAAGATTCACATTGATAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-737s1c1
Sequence:CCGGCCTTCCAGAGAAAGTGCGAAACTCGAGTTTCGCACTTTCTCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016763
VALIDATED
HSD17B10 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-813s1c1
Sequence:CCGGGCTCATCTGGTACAGACCATACTCGAGTATGGTCTGTACCAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-272s1c1
Sequence:CCGGGTTAGGAGAAAGCTGCATATTCTCGAGAATATGCAGCTTTCTCCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-375s1c1
Sequence:CCGGGCTGTCAACTGTGCAGGTATTCTCGAGAATACCTGCACAGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-459s1c1
Sequence:CCGGCGGGTTATCAATGTGAATCTTCTCGAGAAGATTCACATTGATAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016763.1-737s1c1
Sequence:CCGGCCTTCCAGAGAAAGTGCGAAACTCGAGTTTCGCACTTTCTCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)