EMAIL THIS PAGE TO A FRIEND

HSD17B11

hydroxysteroid (17-beta) dehydrogenase 11

81 Gene Product Result for
Synonyms: 17BHSD11 DHRS8 PAN1B RETSDR2 SDR16C2
UniProtKB ID: Q8NBQ5, Q96HF6, Q9UKU4
Gene ID:
Human(51170) Summary: Short-chain alcohol dehydrogenases, such as HSD17B11, metabolize secondary alcohols and ketones (Brereton et al., 2001 [PubMed 11165019]
Mouse(114664) hydroxysteroid (17-beta) dehydrogenase 11
Rat(289456) hydroxysteroid (17-beta) dehydrogenase 11
sheep(101122787) hydroxysteroid (17-beta) dehydrogenase 11
domestic guinea pig(100736115) hydroxysteroid (17-beta) dehydrogenase 11
naked mole-rat(101722437) hydroxysteroid (17-beta) dehydrogenase 11
chicken(422588) hydroxysteroid (17-beta) dehydrogenase 11
domestic cat(101096312) hydroxysteroid (17-beta) dehydrogenase 11
cow(527592) hydroxysteroid (17-beta) dehydrogenase 11
dog(487848) hydroxysteroid (17-beta) dehydrogenase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016245 Rosetta Predictions human pricing
NM_001004209 Rosetta Predictions rat pricing
NM_053262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087350 predicted 763
2 SASI_Hs01_00087352 predicted 1088
3 SASI_Hs01_00087353 predicted 709
4 SASI_Hs01_00087354 predicted 715
5 SASI_Hs01_00087355 predicted 666
6 SASI_Hs01_00087356 predicted 597
7 SASI_Hs01_00087357 predicted 519
8 SASI_Hs01_00087358 predicted 1079
9 SASI_Hs02_00349118 predicted 665
10 SASI_Hs02_00349119 predicted 611
11 SASI_Hs01_00087351 predicted 665
12 SASI_Hs01_00087359 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033083 predicted 903
2 SASI_Rn01_00033084 predicted 527
3 SASI_Rn01_00033085 predicted 388
4 SASI_Rn01_00033086 predicted 869
5 SASI_Rn02_00198188 predicted 886
6 SASI_Rn01_00033088 predicted 402
7 SASI_Rn01_00033089 predicted 212
8 SASI_Rn01_00033090 predicted 972
9 SASI_Rn01_00033091 predicted 520
10 SASI_Rn02_00198189 predicted 271
11 SASI_Rn01_00033082 predicted 1003
12 SASI_Rn01_00033087 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337893 predicted 920
2 SASI_Mm01_00100888 predicted 838
3 SASI_Mm02_00337894 predicted 545
4 SASI_Mm01_00100892 predicted 388
5 SASI_Mm01_00100889 predicted 907
6 SASI_Mm01_00100890 predicted 212
7 SASI_Mm02_00337895 predicted 398
8 SASI_Mm01_00100893 predicted 232
9 SASI_Mm01_00100894 predicted 235
10 SASI_Mm01_00100891 predicted 391
11 SASI_Mm01_00100895 predicted 355
12 SASI_Mm01_00100896 predicted 919
13 SASI_Mm01_00100897 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016245
VALIDATED
HSD17B11 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-700s21c1
Sequence:CCGGTTCCTGCAATGACGAAGAATACTCGAGTATTCTTCGTCATTGCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1564s21c1
Sequence:CCGGGGACTATATCTAGTGGTATTTCTCGAGAAATACCACTAGATATAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-419s21c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1090s21c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1439s21c1
Sequence:CCGGTTGTACCATAACCGTTTATTTCTCGAGAAATAAACGGTTATGGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-374s1c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-751s1c1
Sequence:CCGGGCAAGTTTGCTGCTGTTGGATCTCGAGATCCAACAGCAGCAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-345s1c1
Sequence:CCGGGCCTATGAATTTGCTAAACTTCTCGAGAAGTTTAGCAAATTCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-553s1c1
Sequence:CCGGGTGTAGTCTATACATCAGATTCTCGAGAATCTGATGTATAGACTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-1045s1c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016245
VALIDATED
HSD17B11 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-700s21c1
Sequence:CCGGTTCCTGCAATGACGAAGAATACTCGAGTATTCTTCGTCATTGCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1564s21c1
Sequence:CCGGGGACTATATCTAGTGGTATTTCTCGAGAAATACCACTAGATATAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-419s21c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1090s21c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1439s21c1
Sequence:CCGGTTGTACCATAACCGTTTATTTCTCGAGAAATAAACGGTTATGGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-374s1c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-751s1c1
Sequence:CCGGGCAAGTTTGCTGCTGTTGGATCTCGAGATCCAACAGCAGCAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-345s1c1
Sequence:CCGGGCCTATGAATTTGCTAAACTTCTCGAGAAGTTTAGCAAATTCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-553s1c1
Sequence:CCGGGTGTAGTCTATACATCAGATTCTCGAGAATCTGATGTATAGACTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-1045s1c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016245
VALIDATED
HSD17B11 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-700s21c1
Sequence:CCGGTTCCTGCAATGACGAAGAATACTCGAGTATTCTTCGTCATTGCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1564s21c1
Sequence:CCGGGGACTATATCTAGTGGTATTTCTCGAGAAATACCACTAGATATAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-419s21c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1090s21c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016245.3-1439s21c1
Sequence:CCGGTTGTACCATAACCGTTTATTTCTCGAGAAATAAACGGTTATGGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-374s1c1
Sequence:CCGGGCTGGTTCTCTGGGATATAAACTCGAGTTTATATCCCAGAGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-751s1c1
Sequence:CCGGGCAAGTTTGCTGCTGTTGGATCTCGAGATCCAACAGCAGCAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-345s1c1
Sequence:CCGGGCCTATGAATTTGCTAAACTTCTCGAGAAGTTTAGCAAATTCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-553s1c1
Sequence:CCGGGTGTAGTCTATACATCAGATTCTCGAGAATCTGATGTATAGACTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016245.1-1045s1c1
Sequence:CCGGGTGTTAAGTTTGATGCAGTTACTCGAGTAACTGCATCAAACTTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053262
VALIDATED
HSD17B11 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-108s21c2
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-239s21c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-215s21c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-842s21c3
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-215s1c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-239s1c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-711s1c1
Sequence:CCGGCAACTTCATAAACACCGGCTTCTCGAGAAGCCGGTGTTTATGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-108s1c1
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-842s1c1
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053262
VALIDATED
HSD17B11 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-108s21c2
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-239s21c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-215s21c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-842s21c3
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-215s1c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-239s1c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-711s1c1
Sequence:CCGGCAACTTCATAAACACCGGCTTCTCGAGAAGCCGGTGTTTATGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-108s1c1
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-842s1c1
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053262
VALIDATED
HSD17B11 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-108s21c2
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-239s21c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-215s21c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053262.3-842s21c3
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-215s1c1
Sequence:CCGGCCTACGAATTTGCCAAACTTACTCGAGTAAGTTTGGCAAATTCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-239s1c1
Sequence:CCGGCCAAACTGGTTCTCTGGGATACTCGAGTATCCCAGAGAACCAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053262.2-711s1c1
Sequence:CCGGCAACTTCATAAACACCGGCTTCTCGAGAAGCCGGTGTTTATGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-108s1c1
Sequence:CCGGCAGCATTGAGTCTCTTGTCAACTCGAGTTGACAAGAGACTCAATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053262.2-842s1c1
Sequence:CCGGCCATAGCACTTCTGACAGTATCTCGAGATACTGTCAGAAGTGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)