EMAIL THIS PAGE TO A FRIEND

HSD17B12

hydroxysteroid (17-beta) dehydrogenase 12

70 Gene Product Result for
Synonyms: KAR SDR12C1
UniProtKB ID: Q53GQ0, A8K9B0, D3DR23, Q96JU2, Q9Y6G8
Gene ID:
Human(51144) Summary: This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
Mouse(56348) hydroxysteroid (17-beta) dehydrogenase 12
Rat(84013) hydroxysteroid (17-beta) dehydrogenase 12
chicken(769787) hydroxysteroid (17-beta) dehydrogenase 12
cow(789567) hydroxysteroid (17-beta) dehydrogenase 12
domestic cat(101082595) hydroxysteroid (17-beta) dehydrogenase 12
dog(475939) hydroxysteroid (17-beta) dehydrogenase 12
domestic guinea pig(100730531) hydroxysteroid (17-beta) dehydrogenase 12
naked mole-rat(101717552) hydroxysteroid (17-beta) dehydrogenase 12
sheep(101110086) hydroxysteroid (17-beta) dehydrogenase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016142 Rosetta Predictions human pricing
NM_032066 Rosetta Predictions rat pricing
NM_019657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348935 predicted 1165
2 SASI_Hs01_00047462 predicted 1129
3 SASI_Hs01_00047463 predicted 1056
4 SASI_Hs01_00047464 predicted 543
5 SASI_Hs01_00047465 predicted 784
6 SASI_Hs02_00348936 predicted 1157
7 SASI_Hs01_00047466 predicted 638
8 SASI_Hs01_00047467 predicted 668
9 SASI_Hs01_00047468 predicted 529
10 SASI_Hs01_00047469 predicted 1053
11 SASI_Hs01_00047460 predicted 667
12 SASI_Hs01_00047461 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100638 predicted 419
2 SASI_Rn01_00100639 predicted 831
3 SASI_Rn01_00100640 predicted 461
4 SASI_Rn01_00100641 predicted 317
5 SASI_Rn02_00265423 predicted 265
6 SASI_Rn01_00100644 predicted 471
7 SASI_Rn01_00100645 predicted 224
8 SASI_Rn01_00100646 predicted 302
9 SASI_Rn01_00100647 predicted 559
10 SASI_Rn02_00265424 predicted 620
11 SASI_Rn01_00100642 predicted 415
12 SASI_Rn01_00100643 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109496 predicted 492
2 SASI_Mm01_00109497 predicted 343
3 SASI_Mm01_00109498 predicted 302
4 SASI_Mm01_00109499 predicted 455
5 SASI_Mm01_00109501 predicted 439
6 SASI_Mm01_00109502 predicted 1009
7 SASI_Mm01_00109503 predicted 498
8 SASI_Mm01_00109504 predicted 966
9 SASI_Mm01_00109505 predicted 1057
10 SASI_Mm02_00324706 predicted 1001
11 SASI_Mm01_00109500 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019657
VALIDATED
HSD17B12 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-469s21c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-944s21c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-622s21c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-871s21c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-470s1c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-623s1c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-945s1c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-872s1c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-291s1c1
Sequence:CCGGCAAGATAAACTGAATCAGGTTCTCGAGAACCTGATTCAGTTTATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019657
VALIDATED
HSD17B12 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-469s21c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-944s21c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-622s21c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-871s21c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-470s1c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-623s1c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-945s1c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-872s1c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-291s1c1
Sequence:CCGGCAAGATAAACTGAATCAGGTTCTCGAGAACCTGATTCAGTTTATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019657
VALIDATED
HSD17B12 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-469s21c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-944s21c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-622s21c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019657.4-871s21c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-470s1c1
Sequence:CCGGCTTTCTGGAAATTCCCGACTTCTCGAGAAGTCGGGAATTTCCAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-623s1c1
Sequence:CCGGCCCAGTTCCATTGTTGACAATCTCGAGATTGTCAACAATGGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-945s1c1
Sequence:CCGGCGGAATCGCTACCTGAAGAAACTCGAGTTTCTTCAGGTAGCGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-872s1c1
Sequence:CCGGCATGGGCTCAATAAACTCAATCTCGAGATTGAGTTTATTGAGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019657.2-291s1c1
Sequence:CCGGCAAGATAAACTGAATCAGGTTCTCGAGAACCTGATTCAGTTTATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016142
VALIDATED
HSD17B12 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1354s21c1
Sequence:CCGGGGATACTATCCGAGGTAATTTCTCGAGAAATTACCTCGGATAGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1061s21c1
Sequence:CCGGGCTCTTATGGGCTCGATAATCCTCGAGGATTATCGAGCCCATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-307s21c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-894s21c1
Sequence:CCGGATAGGAGCAAGGGCGTCTTTGCTCGAGCAAAGACGCCCTTGCTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-145s1c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-925s1c1
Sequence:CCGGCCTGCCTTCTTGGATTTATTTCTCGAGAAATAAATCCAAGAAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016142.1-799s1c1
Sequence:CCGGCCGGAAGCCAACTTTGGATAACTCGAGTTATCCAAAGTTGGCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-977s1c1
Sequence:CCGGCGGGCTCACTATCTGAAGAAACTCGAGTTTCTTCAGATAGTGAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-472s1c1
Sequence:CCGGCGTGGGAATGTCGTATGAGTACTCGAGTACTCATACGACATTCCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016142.2-822s21c1
Sequence:CCGGTCCCACTCTTGACCATCTATTCTCGAGAATAGATGGTCAAGAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016142
VALIDATED
HSD17B12 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1354s21c1
Sequence:CCGGGGATACTATCCGAGGTAATTTCTCGAGAAATTACCTCGGATAGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1061s21c1
Sequence:CCGGGCTCTTATGGGCTCGATAATCCTCGAGGATTATCGAGCCCATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-307s21c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-894s21c1
Sequence:CCGGATAGGAGCAAGGGCGTCTTTGCTCGAGCAAAGACGCCCTTGCTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-145s1c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-925s1c1
Sequence:CCGGCCTGCCTTCTTGGATTTATTTCTCGAGAAATAAATCCAAGAAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016142.1-799s1c1
Sequence:CCGGCCGGAAGCCAACTTTGGATAACTCGAGTTATCCAAAGTTGGCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-977s1c1
Sequence:CCGGCGGGCTCACTATCTGAAGAAACTCGAGTTTCTTCAGATAGTGAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-472s1c1
Sequence:CCGGCGTGGGAATGTCGTATGAGTACTCGAGTACTCATACGACATTCCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016142.2-822s21c1
Sequence:CCGGTCCCACTCTTGACCATCTATTCTCGAGAATAGATGGTCAAGAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016142
VALIDATED
HSD17B12 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1354s21c1
Sequence:CCGGGGATACTATCCGAGGTAATTTCTCGAGAAATTACCTCGGATAGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-1061s21c1
Sequence:CCGGGCTCTTATGGGCTCGATAATCCTCGAGGATTATCGAGCCCATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-307s21c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016142.2-894s21c1
Sequence:CCGGATAGGAGCAAGGGCGTCTTTGCTCGAGCAAAGACGCCCTTGCTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-145s1c1
Sequence:CCGGGCGTATTTCGTACTCGCTCTTCTCGAGAAGAGCGAGTACGAAATACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-925s1c1
Sequence:CCGGCCTGCCTTCTTGGATTTATTTCTCGAGAAATAAATCCAAGAAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016142.1-799s1c1
Sequence:CCGGCCGGAAGCCAACTTTGGATAACTCGAGTTATCCAAAGTTGGCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-977s1c1
Sequence:CCGGCGGGCTCACTATCTGAAGAAACTCGAGTTTCTTCAGATAGTGAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016142.1-472s1c1
Sequence:CCGGCGTGGGAATGTCGTATGAGTACTCGAGTACTCATACGACATTCCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016142.2-822s21c1
Sequence:CCGGTCCCACTCTTGACCATCTATTCTCGAGAATAGATGGTCAAGAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)