EMAIL THIS PAGE TO A FRIEND

HSD17B14

hydroxysteroid (17-beta) dehydrogenase 14

51 Gene Product Result for
Synonyms: DHRS10 SDR47C1 retSDR3
UniProtKB ID: Q9BPX1, Q9UKU3
Gene ID:
Human(51171) Summary: 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]
Mouse(66065) hydroxysteroid (17-beta) dehydrogenase 14
Rat(691018) hydroxysteroid (17-beta) dehydrogenase 14
domestic guinea pig(100727836) hydroxysteroid (17-beta) dehydrogenase 14
naked mole-rat(101716482) hydroxysteroid (17-beta) dehydrogenase 14
sheep(101123575) hydroxysteroid (17-beta) dehydrogenase 14
Zebrafish(445127) hydroxysteroid (17-beta) dehydrogenase 14
dog(476420) hydroxysteroid (17-beta) dehydrogenase 14
cow(282652) hydroxysteroid (17-beta) dehydrogenase 14
domestic cat(101080341) hydroxysteroid (17-beta) dehydrogenase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016246 Rosetta Predictions human pricing
XM_001076540 Rosetta Predictions rat pricing
NM_025330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032939 predicted 511
2 SASI_Hs01_00032940 predicted 779
3 SASI_Hs01_00032941 predicted 968
4 SASI_Hs01_00032943 predicted 490
5 SASI_Hs02_00349120 predicted 498
6 SASI_Hs01_00032944 predicted 776
7 SASI_Hs01_00032945 predicted 741
8 SASI_Hs02_00349121 predicted 651
9 SASI_Hs02_00349122 predicted 967
10 SASI_Hs02_00349123 predicted 767
11 SASI_Hs01_00032942 predicted 662
12 SASI_Hs01_00032946 predicted 472
13 SASI_Hs01_00032947 predicted 657
14 SASI_Hs01_00032948 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353634 predicted 201
2 SASI_Rn02_00353635 predicted 240
3 SASI_Rn02_00353636 predicted 198
4 SASI_Rn02_00353637 predicted 349
5 SASI_Rn02_00353638 predicted 222
6 SASI_Rn02_00353639 predicted 443
7 SASI_Rn02_00353640 predicted 276
8 SASI_Rn02_00353641 predicted 208
9 SASI_Rn02_00353642 predicted 220
10 SASI_Rn02_00353643 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106857 predicted 706
2 SASI_Mm01_00106858 predicted 323
3 SASI_Mm01_00106859 predicted 638
4 SASI_Mm01_00106860 predicted 354
5 SASI_Mm01_00106861 predicted 344
6 SASI_Mm01_00106862 predicted 627
7 SASI_Mm01_00106863 predicted 539
8 SASI_Mm01_00106864 predicted 644
9 SASI_Mm01_00106865 predicted 652
10 SASI_Mm01_00106866 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025330
HSD17B14 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-472s1c1
Sequence:CCGGGTATGGACGCAAGGCTAGTAACTCGAGTTACTAGCCTTGCGTCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-512s1c1
Sequence:CCGGCCCACTCTCCCACCTAATGTACTCGAGTACATTAGGTGGGAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-234s1c1
Sequence:CCGGGCAGACATGGTGTCCGAGTCACTCGAGTGACTCGGACACCATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-268s1c1
Sequence:CCGGAGGAAACATCTGGACTCCACTCTCGAGAGTGGAGTCCAGATGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-421s1c1
Sequence:CCGGCACCTTCTGTACAGGGCTTGACTCGAGTCAAGCCCTGTACAGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025330
HSD17B14 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-472s1c1
Sequence:CCGGGTATGGACGCAAGGCTAGTAACTCGAGTTACTAGCCTTGCGTCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-512s1c1
Sequence:CCGGCCCACTCTCCCACCTAATGTACTCGAGTACATTAGGTGGGAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-234s1c1
Sequence:CCGGGCAGACATGGTGTCCGAGTCACTCGAGTGACTCGGACACCATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-268s1c1
Sequence:CCGGAGGAAACATCTGGACTCCACTCTCGAGAGTGGAGTCCAGATGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-421s1c1
Sequence:CCGGCACCTTCTGTACAGGGCTTGACTCGAGTCAAGCCCTGTACAGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025330
HSD17B14 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-472s1c1
Sequence:CCGGGTATGGACGCAAGGCTAGTAACTCGAGTTACTAGCCTTGCGTCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-512s1c1
Sequence:CCGGCCCACTCTCCCACCTAATGTACTCGAGTACATTAGGTGGGAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-234s1c1
Sequence:CCGGGCAGACATGGTGTCCGAGTCACTCGAGTGACTCGGACACCATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-268s1c1
Sequence:CCGGAGGAAACATCTGGACTCCACTCTCGAGAGTGGAGTCCAGATGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025330.1-421s1c1
Sequence:CCGGCACCTTCTGTACAGGGCTTGACTCGAGTCAAGCCCTGTACAGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016246
HSD17B14 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-508s1c1
Sequence:CCGGTCAAGGGAATGTCATCAACATCTCGAGATGTTGATGACATTCCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-214s1c1
Sequence:CCGGCCGAGTGGTTATCTGCGACAACTCGAGTTGTCGCAGATAACCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-358s1c1
Sequence:CCGGCCTGGATTGTGTTGTCAACAACTCGAGTTGTTGACAACACAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-617s1c1
Sequence:CCGGGCCCTGGATGAAAGTCCATATCTCGAGATATGGACTTTCATCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-278s1c1
Sequence:CCGGGCTGTCTTTATCCTCTGTGATCTCGAGATCACAGAGGATAAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-974s21c1
Sequence:CCGGCTTCTGCACGGGCATTGAACTCTCGAGAGTTCAATGCCCGTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016246.2-1125s21c1
Sequence:CCGGCCCAAACTCCAACCTGTATCACTCGAGTGATACAGGTTGGAGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-1063s21c1
Sequence:CCGGCCGATATCCCTTCCTGATTTCCTCGAGGAAATCAGGAAGGGATATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-794s21c1
Sequence:CCGGTGTCCGAGTCAACTGTATCTCCTCGAGGAGATACAGTTGACTCGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016246
HSD17B14 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-508s1c1
Sequence:CCGGTCAAGGGAATGTCATCAACATCTCGAGATGTTGATGACATTCCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-214s1c1
Sequence:CCGGCCGAGTGGTTATCTGCGACAACTCGAGTTGTCGCAGATAACCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-358s1c1
Sequence:CCGGCCTGGATTGTGTTGTCAACAACTCGAGTTGTTGACAACACAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-617s1c1
Sequence:CCGGGCCCTGGATGAAAGTCCATATCTCGAGATATGGACTTTCATCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-278s1c1
Sequence:CCGGGCTGTCTTTATCCTCTGTGATCTCGAGATCACAGAGGATAAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-974s21c1
Sequence:CCGGCTTCTGCACGGGCATTGAACTCTCGAGAGTTCAATGCCCGTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016246.2-1125s21c1
Sequence:CCGGCCCAAACTCCAACCTGTATCACTCGAGTGATACAGGTTGGAGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-1063s21c1
Sequence:CCGGCCGATATCCCTTCCTGATTTCCTCGAGGAAATCAGGAAGGGATATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-794s21c1
Sequence:CCGGTGTCCGAGTCAACTGTATCTCCTCGAGGAGATACAGTTGACTCGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016246
HSD17B14 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-508s1c1
Sequence:CCGGTCAAGGGAATGTCATCAACATCTCGAGATGTTGATGACATTCCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-214s1c1
Sequence:CCGGCCGAGTGGTTATCTGCGACAACTCGAGTTGTCGCAGATAACCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-358s1c1
Sequence:CCGGCCTGGATTGTGTTGTCAACAACTCGAGTTGTTGACAACACAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-617s1c1
Sequence:CCGGGCCCTGGATGAAAGTCCATATCTCGAGATATGGACTTTCATCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016246.1-278s1c1
Sequence:CCGGGCTGTCTTTATCCTCTGTGATCTCGAGATCACAGAGGATAAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-974s21c1
Sequence:CCGGCTTCTGCACGGGCATTGAACTCTCGAGAGTTCAATGCCCGTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016246.2-1125s21c1
Sequence:CCGGCCCAAACTCCAACCTGTATCACTCGAGTGATACAGGTTGGAGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-1063s21c1
Sequence:CCGGCCGATATCCCTTCCTGATTTCCTCGAGGAAATCAGGAAGGGATATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016246.2-794s21c1
Sequence:CCGGTGTCCGAGTCAACTGTATCTCCTCGAGGAGATACAGTTGACTCGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)