EMAIL THIS PAGE TO A FRIEND

HSD17B1

hydroxysteroid (17-beta) dehydrogenase 1

61 Gene Product Result for
Synonyms: EDH17B2 EDHB17 HSD17 SDR28C1
UniProtKB ID: P14061, B3KXS1, Q2M2L8
Gene ID:
Mouse(15485) hydroxysteroid (17-beta) dehydrogenase 1
Rat(25322) hydroxysteroid (17-beta) dehydrogenase 1
sheep(101110778) hydroxysteroid (17-beta) dehydrogenase 1
Domestic Rabbit(100009478) hydroxysteroid (17-beta) dehydrogenase 1
domestic guinea pig(100718199) hydroxysteroid (17-beta) dehydrogenase 1
naked mole-rat(101720493) hydroxysteroid (17-beta) dehydrogenase 1
Zebrafish(402842) hydroxysteroid (17-beta) dehydrogenase 1
cow(785989) hydroxysteroid (17-beta) dehydrogenase 1-like
chicken(395641) hydroxysteroid (17-beta) dehydrogenase 1
domestic cat(101091417) hydroxysteroid (17-beta) dehydrogenase 1
cow(353107) hydroxysteroid (17-beta) dehydrogenase 1
Horse(100036556) hydroxysteroid (17-beta) dehydrogenase 1
dog(607570) hydroxysteroid (17-beta) dehydrogenase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E9750 Estrone ≥99% human, mouse, rat pricing
E1274 Estrone meets USP testing specifications human, mouse, rat pricing
S3378 Spironolactone 97.0-103.0% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054601 MISSION® esiRNA esiRNA human HSD17B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000413 Rosetta Predictions human pricing
NM_012851 Rosetta Predictions rat pricing
NM_010475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130656 predicted 1019
2 SASI_Hs01_00130658 predicted 1284
3 SASI_Hs01_00130659 predicted 1291
4 SASI_Hs02_00302506 predicted 1421
5 SASI_Hs02_00302507 predicted 1018
6 SASI_Hs02_00302508 predicted 1146
7 SASI_Hs01_00130657 predicted 1413
8 SASI_Hs02_00302509 predicted 1050
9 SASI_Hs01_00130660 predicted 1452
10 SASI_Hs01_00130661 predicted 1413
11 SASI_Hs01_00130662 predicted 1452
12 SASI_Hs01_00130663 predicted 1543
13 SASI_Hs01_00130664 predicted 1446
14 SASI_Hs01_00130665 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121665 predicted 732
2 SASI_Rn01_00121666 predicted 1060
3 SASI_Rn01_00121667 predicted 745
4 SASI_Rn01_00121669 predicted 698
5 SASI_Rn02_00260327 predicted 805
6 SASI_Rn01_00121670 predicted 850
7 SASI_Rn01_00121671 predicted 520
8 SASI_Rn01_00121672 predicted 1015
9 SASI_Rn01_00121673 predicted 1002
10 SASI_Rn01_00121674 predicted 1039
11 SASI_Rn01_00121668 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026957 predicted 275
2 SASI_Mm02_00318684 predicted 725
3 SASI_Mm02_00318685 predicted 1012
4 SASI_Mm01_00026958 predicted 509
5 SASI_Mm01_00026960 predicted 677
6 SASI_Mm01_00026962 predicted 298
7 SASI_Mm02_00318686 predicted 1025
8 SASI_Mm01_00026963 predicted 685
9 SASI_Mm01_00026964 predicted 742
10 SASI_Mm01_00026965 predicted 276
11 SASI_Mm01_00026959 predicted 355
12 SASI_Mm01_00026961 predicted 200
13 SASI_Mm01_00026966 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000413
HSD17B1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1447s21c1
Sequence:CCGGAGTTCGCGCTCGAAGGCTTATCTCGAGATAAGCCTTCGAGCGCGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000413.2-2057s21c1
Sequence:CCGGATAGATCGCGTTAGCCAGTTTCTCGAGAAACTGGCTAACGCGATCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1308s21c1
Sequence:CCGGGTGAATGTAGTAGGGACTGTGCTCGAGCACAGTCCCTACTACATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1045s21c1
Sequence:CCGGATCCATCCCAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTGGGATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1598s1c1
Sequence:CCGGCCACACCTTCCACCGCTTCTACTCGAGTAGAAGCGGTGGAAGGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1812s1c1
Sequence:CCGGCGGGAAGTGTTCGGCGACGTTCTCGAGAACGTCGCCGAACACTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1160s1c1
Sequence:CCGGGCTGGACGTAAGGGACTCAAACTCGAGTTTGAGTCCCTTACGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1415s1c1
Sequence:CCGGGCTGCCTTTCAATGACGTTTACTCGAGTAAACGTCATTGAAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1071s1c1
Sequence:CCGGGCCACGTTGAGGGACCTGAAACTCGAGTTTCAGGTCCCTCAACGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000413
HSD17B1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1447s21c1
Sequence:CCGGAGTTCGCGCTCGAAGGCTTATCTCGAGATAAGCCTTCGAGCGCGAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000413.2-2057s21c1
Sequence:CCGGATAGATCGCGTTAGCCAGTTTCTCGAGAAACTGGCTAACGCGATCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1308s21c1
Sequence:CCGGGTGAATGTAGTAGGGACTGTGCTCGAGCACAGTCCCTACTACATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1045s21c1
Sequence:CCGGATCCATCCCAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTGGGATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1598s1c1
Sequence:CCGGCCACACCTTCCACCGCTTCTACTCGAGTAGAAGCGGTGGAAGGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1812s1c1
Sequence:CCGGCGGGAAGTGTTCGGCGACGTTCTCGAGAACGTCGCCGAACACTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1160s1c1
Sequence:CCGGGCTGGACGTAAGGGACTCAAACTCGAGTTTGAGTCCCTTACGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1415s1c1
Sequence:CCGGGCTGCCTTTCAATGACGTTTACTCGAGTAAACGTCATTGAAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1071s1c1
Sequence:CCGGGCCACGTTGAGGGACCTGAAACTCGAGTTTCAGGTCCCTCAACGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000413
HSD17B1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1447s21c1
Sequence:CCGGAGTTCGCGCTCGAAGGCTTATCTCGAGATAAGCCTTCGAGCGCGAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000413.2-2057s21c1
Sequence:CCGGATAGATCGCGTTAGCCAGTTTCTCGAGAAACTGGCTAACGCGATCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1308s21c1
Sequence:CCGGGTGAATGTAGTAGGGACTGTGCTCGAGCACAGTCCCTACTACATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000413.2-1045s21c1
Sequence:CCGGATCCATCCCAGAGCTTCAAAGCTCGAGCTTTGAAGCTCTGGGATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1598s1c1
Sequence:CCGGCCACACCTTCCACCGCTTCTACTCGAGTAGAAGCGGTGGAAGGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1812s1c1
Sequence:CCGGCGGGAAGTGTTCGGCGACGTTCTCGAGAACGTCGCCGAACACTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1160s1c1
Sequence:CCGGGCTGGACGTAAGGGACTCAAACTCGAGTTTGAGTCCCTTACGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1415s1c1
Sequence:CCGGGCTGCCTTTCAATGACGTTTACTCGAGTAAACGTCATTGAAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000413.1-1071s1c1
Sequence:CCGGGCCACGTTGAGGGACCTGAAACTCGAGTTTCAGGTCCCTCAACGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010475
HSD17B1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-956s1c1
Sequence:CCGGGCCCTCATTTGCCTCCCTGAACTCGAGTTCAGGGAGGCAAATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-120s1c1
Sequence:CCGGGCTTCAAAGTTTATGCCACATCTCGAGATGTGGCATAAACTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-503s1c1
Sequence:CCGGGCCAGCAAGTTTGCGCTCGAACTCGAGTTCGAGCGCAAACTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-325s1c1
Sequence:CCGGGCCGCTAGAAGCACATGAATTCTCGAGAATTCATGTGCTTCTAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-282s1c1
Sequence:CCGGGTGTGGATGTACTGGTCTGTACTCGAGTACAGACCAGTACATCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010475
HSD17B1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-956s1c1
Sequence:CCGGGCCCTCATTTGCCTCCCTGAACTCGAGTTCAGGGAGGCAAATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-120s1c1
Sequence:CCGGGCTTCAAAGTTTATGCCACATCTCGAGATGTGGCATAAACTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-503s1c1
Sequence:CCGGGCCAGCAAGTTTGCGCTCGAACTCGAGTTCGAGCGCAAACTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-325s1c1
Sequence:CCGGGCCGCTAGAAGCACATGAATTCTCGAGAATTCATGTGCTTCTAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-282s1c1
Sequence:CCGGGTGTGGATGTACTGGTCTGTACTCGAGTACAGACCAGTACATCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010475
HSD17B1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-956s1c1
Sequence:CCGGGCCCTCATTTGCCTCCCTGAACTCGAGTTCAGGGAGGCAAATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-120s1c1
Sequence:CCGGGCTTCAAAGTTTATGCCACATCTCGAGATGTGGCATAAACTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-503s1c1
Sequence:CCGGGCCAGCAAGTTTGCGCTCGAACTCGAGTTCGAGCGCAAACTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-325s1c1
Sequence:CCGGGCCGCTAGAAGCACATGAATTCTCGAGAATTCATGTGCTTCTAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010475.1-282s1c1
Sequence:CCGGGTGTGGATGTACTGGTCTGTACTCGAGTACAGACCAGTACATCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)