EMAIL THIS PAGE TO A FRIEND

HSD17B2

hydroxysteroid (17-beta) dehydrogenase 2

52 Gene Product Result for
Synonyms: EDH17B2 HSD17 SDR9C2
UniProtKB ID: P37059, B2R7T4
Gene ID:
Mouse(15486) hydroxysteroid (17-beta) dehydrogenase 2
Rat(79243) hydroxysteroid (17-beta) dehydrogenase 2
Zebrafish(449537) hydroxysteroid (17-beta) dehydrogenase 2
chicken(415807) hydroxysteroid (17-beta) dehydrogenase 2
cow(515710) hydroxysteroid (17-beta) dehydrogenase 2
domestic cat(101085592) hydroxysteroid (17-beta) dehydrogenase 2
dog(489690) hydroxysteroid (17-beta) dehydrogenase 2
sheep(100913161) hydroxysteroid (17-beta) dehydrogenase 2
domestic guinea pig(100731231) hydroxysteroid (17-beta) dehydrogenase 2
naked mole-rat(101719685) hydroxysteroid (17-beta) dehydrogenase 2
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002153 Rosetta Predictions human pricing
NM_024391 Rosetta Predictions rat pricing
NM_008290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222253 predicted 846
2 SASI_Hs01_00222254 predicted 1198
3 SASI_Hs01_00222255 predicted 1132
4 SASI_Hs02_00333342 predicted 939
5 SASI_Hs01_00222256 predicted 578
6 SASI_Hs01_00222257 predicted 446
7 SASI_Hs01_00222259 predicted 1139
8 SASI_Hs01_00222260 predicted 303
9 SASI_Hs01_00222261 predicted 1078
10 SASI_Hs01_00222262 predicted 719
11 SASI_Hs01_00222258 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103220 predicted 825
2 SASI_Rn01_00103221 predicted 855
3 SASI_Rn01_00103222 predicted 925
4 SASI_Rn01_00103223 predicted 309
5 SASI_Rn01_00103224 predicted 215
6 SASI_Rn01_00103225 predicted 703
7 SASI_Rn01_00103226 predicted 519
8 SASI_Rn01_00103227 predicted 757
9 SASI_Rn01_00103228 predicted 576
10 SASI_Rn01_00103229 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164525 predicted 758
2 SASI_Mm01_00164526 predicted 744
3 SASI_Mm01_00164527 predicted 430
4 SASI_Mm01_00164528 predicted 723
5 SASI_Mm01_00164529 predicted 487
6 SASI_Mm01_00164531 predicted 502
7 SASI_Mm01_00164532 predicted 650
8 SASI_Mm02_00313568 predicted 1016
9 SASI_Mm01_00164533 predicted 582
10 SASI_Mm01_00164534 predicted 748
11 SASI_Mm01_00164530 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002153
HSD17B2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-456s21c1
Sequence:CCGGGCCATGCTTTGTGCAAGTATCCTCGAGGATACTTGCACAAAGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-1229s21c1
Sequence:CCGGTATTTGCCTATTGGCATATATCTCGAGATATATGCCAATAGGCAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-569s1c1
Sequence:CCGGGCTCCAAATGGACATCACGAACTCGAGTTCGTGATGTCCATTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-487s1c1
Sequence:CCGGTCACGGTATTTGCCGGAGTTTCTCGAGAAACTCCGGCAAATACCGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-884s1c1
Sequence:CCGGGACCATGTTCTCATCAGTTATCTCGAGATAACTGATGAGAACATGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1197s1c1
Sequence:CCGGGCTTACTTGTGGATCTGCCTTCTCGAGAAGGCAGATCCACAAGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1085s1c1
Sequence:CCGGCCTCCTATTGATCAACTCGTTCTCGAGAACGAGTTGATCAATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002153
HSD17B2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-456s21c1
Sequence:CCGGGCCATGCTTTGTGCAAGTATCCTCGAGGATACTTGCACAAAGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-1229s21c1
Sequence:CCGGTATTTGCCTATTGGCATATATCTCGAGATATATGCCAATAGGCAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-569s1c1
Sequence:CCGGGCTCCAAATGGACATCACGAACTCGAGTTCGTGATGTCCATTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-487s1c1
Sequence:CCGGTCACGGTATTTGCCGGAGTTTCTCGAGAAACTCCGGCAAATACCGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-884s1c1
Sequence:CCGGGACCATGTTCTCATCAGTTATCTCGAGATAACTGATGAGAACATGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1197s1c1
Sequence:CCGGGCTTACTTGTGGATCTGCCTTCTCGAGAAGGCAGATCCACAAGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1085s1c1
Sequence:CCGGCCTCCTATTGATCAACTCGTTCTCGAGAACGAGTTGATCAATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002153
HSD17B2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-456s21c1
Sequence:CCGGGCCATGCTTTGTGCAAGTATCCTCGAGGATACTTGCACAAAGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002153.2-1229s21c1
Sequence:CCGGTATTTGCCTATTGGCATATATCTCGAGATATATGCCAATAGGCAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-569s1c1
Sequence:CCGGGCTCCAAATGGACATCACGAACTCGAGTTCGTGATGTCCATTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-487s1c1
Sequence:CCGGTCACGGTATTTGCCGGAGTTTCTCGAGAAACTCCGGCAAATACCGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-884s1c1
Sequence:CCGGGACCATGTTCTCATCAGTTATCTCGAGATAACTGATGAGAACATGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1197s1c1
Sequence:CCGGGCTTACTTGTGGATCTGCCTTCTCGAGAAGGCAGATCCACAAGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002153.1-1085s1c1
Sequence:CCGGCCTCCTATTGATCAACTCGTTCTCGAGAACGAGTTGATCAATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008290
HSD17B2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-626s1c1
Sequence:CCGGGCCTCTACTTAGAAAGTCCAACTCGAGTTGGACTTTCTAAGTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-682s1c1
Sequence:CCGGCGGTTCCACTTCAAATGACATCTCGAGATGTCATTTGAAGTGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-777s1c1
Sequence:CCGGGTTAAAGTTGTGACCATCAAACTCGAGTTTGATGGTCACAACTTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-237s1c1
Sequence:CCGGCAAGACTTGTTACCTGTGGATCTCGAGATCCACAGGTAACAAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-914s1c1
Sequence:CCGGCCATACACAGAAGCTCATCATCTCGAGATGATGAGCTTCTGTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008290
HSD17B2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-626s1c1
Sequence:CCGGGCCTCTACTTAGAAAGTCCAACTCGAGTTGGACTTTCTAAGTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-682s1c1
Sequence:CCGGCGGTTCCACTTCAAATGACATCTCGAGATGTCATTTGAAGTGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-777s1c1
Sequence:CCGGGTTAAAGTTGTGACCATCAAACTCGAGTTTGATGGTCACAACTTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-237s1c1
Sequence:CCGGCAAGACTTGTTACCTGTGGATCTCGAGATCCACAGGTAACAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-914s1c1
Sequence:CCGGCCATACACAGAAGCTCATCATCTCGAGATGATGAGCTTCTGTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008290
HSD17B2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-626s1c1
Sequence:CCGGGCCTCTACTTAGAAAGTCCAACTCGAGTTGGACTTTCTAAGTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-682s1c1
Sequence:CCGGCGGTTCCACTTCAAATGACATCTCGAGATGTCATTTGAAGTGGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-777s1c1
Sequence:CCGGGTTAAAGTTGTGACCATCAAACTCGAGTTTGATGGTCACAACTTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-237s1c1
Sequence:CCGGCAAGACTTGTTACCTGTGGATCTCGAGATCCACAGGTAACAAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008290.1-914s1c1
Sequence:CCGGCCATACACAGAAGCTCATCATCTCGAGATGATGAGCTTCTGTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)