EMAIL THIS PAGE TO A FRIEND

HSD17B3

hydroxysteroid (17-beta) dehydrogenase 3

58 Gene Product Result for
Synonyms: EDH17B3 SDR12C2
UniProtKB ID: P37058
Gene ID:
Human(3293) Summary: This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Mouse(15487) hydroxysteroid (17-beta) dehydrogenase 3
Rat(117182) hydroxysteroid (17-beta) dehydrogenase 3
domestic guinea pig(100728042) hydroxysteroid (17-beta) dehydrogenase 3
naked mole-rat(101712135) hydroxysteroid (17-beta) dehydrogenase 3
sheep(101111157) hydroxysteroid (17-beta) dehydrogenase 3
Zebrafish(393335) hydroxysteroid (17-beta) dehydrogenase 3
cow(616934) hydroxysteroid (17-beta) dehydrogenase 3
domestic cat(101085324) hydroxysteroid (17-beta) dehydrogenase 3
dog(606956) hydroxysteroid (17-beta) dehydrogenase 3
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E3375 trans-Androsterone human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037511 MISSION® esiRNA esiRNA human HSD17B3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000197 Rosetta Predictions human pricing
NM_054007 Rosetta Predictions rat pricing
NM_008291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160908 predicted 788
2 SASI_Hs02_00302061 predicted 404
3 SASI_Hs01_00160909 predicted 261
4 SASI_Hs02_00302062 predicted 404
5 SASI_Hs01_00160910 predicted 798
6 SASI_Hs01_00160911 predicted 556
7 SASI_Hs02_00302063 predicted 377
8 SASI_Hs01_00160913 predicted 522
9 SASI_Hs02_00302064 predicted 577
10 SASI_Hs01_00160916 predicted 203
11 SASI_Hs01_00160912 predicted 340
12 SASI_Hs01_00160914 predicted 679
13 SASI_Hs01_00160915 predicted 261
14 SASI_Hs01_00160917 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102876 predicted 355
2 SASI_Rn02_00267015 predicted 644
3 SASI_Rn01_00102877 predicted 653
4 SASI_Rn01_00102878 predicted 341
5 SASI_Rn01_00102879 predicted 816
6 SASI_Rn01_00102881 predicted 210
7 SASI_Rn01_00102882 predicted 708
8 SASI_Rn01_00102883 predicted 823
9 SASI_Rn01_00102884 predicted 633
10 SASI_Rn01_00102885 predicted 666
11 SASI_Rn01_00102880 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313569 predicted 384
2 SASI_Mm01_00132962 predicted 696
3 SASI_Mm01_00132963 predicted 555
4 SASI_Mm01_00132965 predicted 579
5 SASI_Mm02_00313570 predicted 383
6 SASI_Mm01_00132966 predicted 551
7 SASI_Mm01_00132967 predicted 318
8 SASI_Mm01_00132968 predicted 270
9 SASI_Mm02_00313571 predicted 350
10 SASI_Mm01_00132969 predicted 232
11 SASI_Mm01_00132960 predicted 251
12 SASI_Mm01_00132961 predicted 375
13 SASI_Mm01_00132964 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000197
HSD17B3 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-516s21c1
Sequence:CCGGTAACATCACCTCCGTAGTCAACTCGAGTTGACTACGGAGGTGATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-679s1c1
Sequence:CCGGGCCCTGCAAGAGGAATATAAACTCGAGTTTATATTCCTCTTGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-219s1c1
Sequence:CCGGCGATGGAATTGGGAAAGCGTACTCGAGTACGCTTTCCCAATTCCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-376s1c1
Sequence:CCGGGATGACATCTACGAGCATATTCTCGAGAATATGCTCGTAGATGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-933s1c1
Sequence:CCGGCCTGACACACTATGTGGCATACTCGAGTATGCCACATAGTGTGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-409s1c1
Sequence:CCGGGCAGGCTTAGAAATTGGAATTCTCGAGAATTCCAATTTCTAAGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-264s21c1
Sequence:CCGGACTCAATGTTGTCCTTATTAGCTCGAGCTAATAAGGACAACATTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-477s21c1
Sequence:CCGGCCTGAACGCACCGGATGAAATCTCGAGATTTCATCCGGTGCGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000197
HSD17B3 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-516s21c1
Sequence:CCGGTAACATCACCTCCGTAGTCAACTCGAGTTGACTACGGAGGTGATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-679s1c1
Sequence:CCGGGCCCTGCAAGAGGAATATAAACTCGAGTTTATATTCCTCTTGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-219s1c1
Sequence:CCGGCGATGGAATTGGGAAAGCGTACTCGAGTACGCTTTCCCAATTCCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-376s1c1
Sequence:CCGGGATGACATCTACGAGCATATTCTCGAGAATATGCTCGTAGATGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-933s1c1
Sequence:CCGGCCTGACACACTATGTGGCATACTCGAGTATGCCACATAGTGTGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-409s1c1
Sequence:CCGGGCAGGCTTAGAAATTGGAATTCTCGAGAATTCCAATTTCTAAGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-264s21c1
Sequence:CCGGACTCAATGTTGTCCTTATTAGCTCGAGCTAATAAGGACAACATTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-477s21c1
Sequence:CCGGCCTGAACGCACCGGATGAAATCTCGAGATTTCATCCGGTGCGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000197
HSD17B3 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-516s21c1
Sequence:CCGGTAACATCACCTCCGTAGTCAACTCGAGTTGACTACGGAGGTGATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-679s1c1
Sequence:CCGGGCCCTGCAAGAGGAATATAAACTCGAGTTTATATTCCTCTTGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-219s1c1
Sequence:CCGGCGATGGAATTGGGAAAGCGTACTCGAGTACGCTTTCCCAATTCCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-376s1c1
Sequence:CCGGGATGACATCTACGAGCATATTCTCGAGAATATGCTCGTAGATGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-933s1c1
Sequence:CCGGCCTGACACACTATGTGGCATACTCGAGTATGCCACATAGTGTGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000197.1-409s1c1
Sequence:CCGGGCAGGCTTAGAAATTGGAATTCTCGAGAATTCCAATTTCTAAGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-264s21c1
Sequence:CCGGACTCAATGTTGTCCTTATTAGCTCGAGCTAATAAGGACAACATTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000197.1-477s21c1
Sequence:CCGGCCTGAACGCACCGGATGAAATCTCGAGATTTCATCCGGTGCGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008291
HSD17B3 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-391s21c1
Sequence:CCGGAGACATCTATGACCATATTAACTCGAGTTAATATGGTCATAGATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-928s1c1
Sequence:CCGGCCTGACACGATACTCAGATTACTCGAGTAATCTGAGTATCGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-222s1c1
Sequence:CCGGGCATCGGGAAAGCCTATTCATCTCGAGATGAATAGGCTTTCCCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-760s1c1
Sequence:CCGGCCTAAATAACAAGATGACCAACTCGAGTTGGTCATCTTGTTATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-496s1c1
Sequence:CCGGCCAGAATCTCATCCACTGCAACTCGAGTTGCAGTGGATGAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-785s1c1
Sequence:CCGGGCCGATGAGTTTGTTAAAGAACTCGAGTTCTTTAACAAACTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-276s21c1
Sequence:CCGGGACTCAATGTTGTACTTATTACTCGAGTAATAAGTACAACATTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008291
HSD17B3 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-391s21c1
Sequence:CCGGAGACATCTATGACCATATTAACTCGAGTTAATATGGTCATAGATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-928s1c1
Sequence:CCGGCCTGACACGATACTCAGATTACTCGAGTAATCTGAGTATCGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-222s1c1
Sequence:CCGGGCATCGGGAAAGCCTATTCATCTCGAGATGAATAGGCTTTCCCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-760s1c1
Sequence:CCGGCCTAAATAACAAGATGACCAACTCGAGTTGGTCATCTTGTTATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-496s1c1
Sequence:CCGGCCAGAATCTCATCCACTGCAACTCGAGTTGCAGTGGATGAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-785s1c1
Sequence:CCGGGCCGATGAGTTTGTTAAAGAACTCGAGTTCTTTAACAAACTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-276s21c1
Sequence:CCGGGACTCAATGTTGTACTTATTACTCGAGTAATAAGTACAACATTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008291
HSD17B3 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-391s21c1
Sequence:CCGGAGACATCTATGACCATATTAACTCGAGTTAATATGGTCATAGATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-928s1c1
Sequence:CCGGCCTGACACGATACTCAGATTACTCGAGTAATCTGAGTATCGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-222s1c1
Sequence:CCGGGCATCGGGAAAGCCTATTCATCTCGAGATGAATAGGCTTTCCCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-760s1c1
Sequence:CCGGCCTAAATAACAAGATGACCAACTCGAGTTGGTCATCTTGTTATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-496s1c1
Sequence:CCGGCCAGAATCTCATCCACTGCAACTCGAGTTGCAGTGGATGAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008291.1-785s1c1
Sequence:CCGGGCCGATGAGTTTGTTAAAGAACTCGAGTTCTTTAACAAACTCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008291.3-276s21c1
Sequence:CCGGGACTCAATGTTGTACTTATTACTCGAGTAATAAGTACAACATTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)