EMAIL THIS PAGE TO A FRIEND

HSD17B4

hydroxysteroid (17-beta) dehydrogenase 4

68 Gene Product Result for
Synonyms: DBP MFE-2 MPF-2 PRLTS1 SDR8C1
UniProtKB ID: P51659, B4DNV1, B4DVS5, E9PB82, F5HE57
Gene ID:
Human(3295) Summary: The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. [provided by RefSeq, Jul 2008]
Mouse(15488) hydroxysteroid (17-beta) dehydrogenase 4
Rat(79244) hydroxysteroid (17-beta) dehydrogenase 4
Zebrafish(393105) hydroxysteroid (17-beta) dehydrogenase 4
domestic cat(101091840) hydroxysteroid (17-beta) dehydrogenase 4
cow(493643) hydroxysteroid (17-beta) dehydrogenase 4
Horse(100034046) hydroxysteroid (17-beta) dehydrogenase 4
dog(474630) hydroxysteroid (17-beta) dehydrogenase 4
chicken(395785) hydroxysteroid (17-beta) dehydrogenase 4
sheep(101114519) hydroxysteroid (17-beta) dehydrogenase 4
domestic guinea pig(100379226) hydroxysteroid (17-beta) dehydrogenase 4
naked mole-rat(101713520) hydroxysteroid (17-beta) dehydrogenase 4
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000414 Rosetta Predictions human pricing
NM_024392 Rosetta Predictions rat pricing
NM_008292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046318 predicted 1993
2 SASI_Hs02_00302510 predicted 1251
3 SASI_Hs01_00046319 predicted 1657
4 SASI_Hs01_00046320 predicted 761
5 SASI_Hs01_00046321 predicted 1547
6 SASI_Hs01_00046322 predicted 1610
7 SASI_Hs01_00046323 predicted 542
8 SASI_Hs01_00046324 predicted 1597
9 SASI_Hs01_00046325 predicted 1981
10 SASI_Hs01_00046326 predicted 2377
11 SASI_Hs01_00046327 predicted 2003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070797 predicted 393
2 SASI_Rn01_00070798 predicted 376
3 SASI_Rn01_00070799 predicted 1625
4 SASI_Rn01_00070801 predicted 1269
5 SASI_Rn01_00070802 predicted 515
6 SASI_Rn01_00070803 predicted 1525
7 SASI_Rn01_00070806 predicted 1470
8 SASI_Rn01_00070804 predicted 1702
9 SASI_Rn01_00070805 predicted 692
10 SASI_Rn02_00263989 predicted 1400
11 SASI_Rn01_00070800 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041414 predicted 1664
2 SASI_Mm01_00041415 predicted 436
3 SASI_Mm01_00041416 predicted 927
4 SASI_Mm01_00041417 predicted 357
5 SASI_Mm01_00041418 predicted 1601
6 SASI_Mm02_00313572 predicted 1296
7 SASI_Mm01_00041420 predicted 487
8 SASI_Mm01_00041421 predicted 1239
9 SASI_Mm01_00041422 predicted 1898
10 SASI_Mm02_00313573 predicted 715
11 SASI_Mm01_00041419 predicted 231
12 SASI_Mm01_00041423 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008292
VALIDATED
HSD17B4 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1558s21c1
Sequence:CCGGTACACATTGACCCGGACTTTGCTCGAGCAAAGTCCGGGTCAATGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-491s21c1
Sequence:CCGGCAACTTTGGCCAGGCGAATTACTCGAGTAATTCGCCTGGCCAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1034s21c1
Sequence:CCGGTACGGAGCTGCAGAGTATTATCTCGAGATAATACTCTGCAGCTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1242s21c1
Sequence:CCGGCAGTACTTGGAGCTGTATAAGCTCGAGCTTATACAGCTCCAAGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1607s1c1
Sequence:CCGGCCATATTACATGGACTATGTACTCGAGTACATAGTCCATGTAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-2321s1c1
Sequence:CCGGGCAGCAGAAATCGCTTCACATCTCGAGATGTGAAGCGATTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1209s1c1
Sequence:CCGGGCTGTCATTCAACTTTGCAAACTCGAGTTTGCAAAGTTGAATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-569s1c1
Sequence:CCGGGCAGGAAGAACAACATTCATTCTCGAGAATGAATGTTGTTCTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-235s1c1
Sequence:CCGGGCCAATTACGATTCAGTTGAACTCGAGTTCAACTGAATCGTAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008292.3-2242s21c1
Sequence:CCGGGTGCTGTTAAAGGAGTCAATACTCGAGTATTGACTCCTTTAACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1676s21c1
Sequence:CCGGATCAAGATTCAAGGCGATTAACTCGAGTTAATCGCCTTGAATCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008292
VALIDATED
HSD17B4 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1558s21c1
Sequence:CCGGTACACATTGACCCGGACTTTGCTCGAGCAAAGTCCGGGTCAATGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-491s21c1
Sequence:CCGGCAACTTTGGCCAGGCGAATTACTCGAGTAATTCGCCTGGCCAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1034s21c1
Sequence:CCGGTACGGAGCTGCAGAGTATTATCTCGAGATAATACTCTGCAGCTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1242s21c1
Sequence:CCGGCAGTACTTGGAGCTGTATAAGCTCGAGCTTATACAGCTCCAAGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1607s1c1
Sequence:CCGGCCATATTACATGGACTATGTACTCGAGTACATAGTCCATGTAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-2321s1c1
Sequence:CCGGGCAGCAGAAATCGCTTCACATCTCGAGATGTGAAGCGATTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1209s1c1
Sequence:CCGGGCTGTCATTCAACTTTGCAAACTCGAGTTTGCAAAGTTGAATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-569s1c1
Sequence:CCGGGCAGGAAGAACAACATTCATTCTCGAGAATGAATGTTGTTCTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-235s1c1
Sequence:CCGGGCCAATTACGATTCAGTTGAACTCGAGTTCAACTGAATCGTAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008292.3-2242s21c1
Sequence:CCGGGTGCTGTTAAAGGAGTCAATACTCGAGTATTGACTCCTTTAACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1676s21c1
Sequence:CCGGATCAAGATTCAAGGCGATTAACTCGAGTTAATCGCCTTGAATCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008292
VALIDATED
HSD17B4 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1558s21c1
Sequence:CCGGTACACATTGACCCGGACTTTGCTCGAGCAAAGTCCGGGTCAATGTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-491s21c1
Sequence:CCGGCAACTTTGGCCAGGCGAATTACTCGAGTAATTCGCCTGGCCAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1034s21c1
Sequence:CCGGTACGGAGCTGCAGAGTATTATCTCGAGATAATACTCTGCAGCTCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1242s21c1
Sequence:CCGGCAGTACTTGGAGCTGTATAAGCTCGAGCTTATACAGCTCCAAGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1607s1c1
Sequence:CCGGCCATATTACATGGACTATGTACTCGAGTACATAGTCCATGTAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-2321s1c1
Sequence:CCGGGCAGCAGAAATCGCTTCACATCTCGAGATGTGAAGCGATTTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008292.2-1209s1c1
Sequence:CCGGGCTGTCATTCAACTTTGCAAACTCGAGTTTGCAAAGTTGAATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-569s1c1
Sequence:CCGGGCAGGAAGAACAACATTCATTCTCGAGAATGAATGTTGTTCTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008292.2-235s1c1
Sequence:CCGGGCCAATTACGATTCAGTTGAACTCGAGTTCAACTGAATCGTAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008292.3-2242s21c1
Sequence:CCGGGTGCTGTTAAAGGAGTCAATACTCGAGTATTGACTCCTTTAACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008292.3-1676s21c1
Sequence:CCGGATCAAGATTCAAGGCGATTAACTCGAGTTAATCGCCTTGAATCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000414
VALIDATED
HSD17B4 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-149s1c1
Sequence:CCGGCGTTAGTTGTTGTGAATGATTCTCGAGAATCATTCACAACAACTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-208s1c1
Sequence:CCGGGCTGCTGATAAGGTTGTTGAACTCGAGTTCAACAACCTTATCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000414.1-1538s1c1
Sequence:CCGGCCTCTCTTAATCAGGCTGCTTCTCGAGAAGCAGCCTGATTAAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-1179s1c1
Sequence:CCGGCGGAGTTATCATAGGTCAGAACTCGAGTTCTGACCTATGATAACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-1990s1c1
Sequence:CCGGGCTGTATTTGAGTGGCATATACTCGAGTATATGCCACTCAAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-459s21c2
Sequence:CCGGTGATGAAGACTGGGATATAATCTCGAGATTATATCCCAGTCTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-990s21c2
Sequence:GTACCGGAGAATCAACTGGCAGTATAATCTCGAGATTATACTGCCAGTTGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-2335s21c2
Sequence:CCGGAGGGCACACTACACTATTAATCTCGAGATTAATAGTGTAGTGTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-545s21c2
Sequence:CCGGAGAAGTATGGAAGGATTATTACTCGAGTAATAATCCTTCCATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-1140s21c2
Sequence:CCGGTACGGAACTGGAAGCTATTATCTCGAGATAATAGCTTCCAGTTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000414
VALIDATED
HSD17B4 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-149s1c1
Sequence:CCGGCGTTAGTTGTTGTGAATGATTCTCGAGAATCATTCACAACAACTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-208s1c1
Sequence:CCGGGCTGCTGATAAGGTTGTTGAACTCGAGTTCAACAACCTTATCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000414.1-1538s1c1
Sequence:CCGGCCTCTCTTAATCAGGCTGCTTCTCGAGAAGCAGCCTGATTAAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-1179s1c1
Sequence:CCGGCGGAGTTATCATAGGTCAGAACTCGAGTTCTGACCTATGATAACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-1990s1c1
Sequence:CCGGGCTGTATTTGAGTGGCATATACTCGAGTATATGCCACTCAAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-459s21c2
Sequence:CCGGTGATGAAGACTGGGATATAATCTCGAGATTATATCCCAGTCTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-990s21c2
Sequence:GTACCGGAGAATCAACTGGCAGTATAATCTCGAGATTATACTGCCAGTTGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-2335s21c2
Sequence:CCGGAGGGCACACTACACTATTAATCTCGAGATTAATAGTGTAGTGTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-545s21c2
Sequence:CCGGAGAAGTATGGAAGGATTATTACTCGAGTAATAATCCTTCCATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-1140s21c2
Sequence:CCGGTACGGAACTGGAAGCTATTATCTCGAGATAATAGCTTCCAGTTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000414
VALIDATED
HSD17B4 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-149s1c1
Sequence:CCGGCGTTAGTTGTTGTGAATGATTCTCGAGAATCATTCACAACAACTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-208s1c1
Sequence:CCGGGCTGCTGATAAGGTTGTTGAACTCGAGTTCAACAACCTTATCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000414.1-1538s1c1
Sequence:CCGGCCTCTCTTAATCAGGCTGCTTCTCGAGAAGCAGCCTGATTAAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000414.1-1179s1c1
Sequence:CCGGCGGAGTTATCATAGGTCAGAACTCGAGTTCTGACCTATGATAACTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000414.1-1990s1c1
Sequence:CCGGGCTGTATTTGAGTGGCATATACTCGAGTATATGCCACTCAAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-459s21c2
Sequence:CCGGTGATGAAGACTGGGATATAATCTCGAGATTATATCCCAGTCTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-990s21c2
Sequence:GTACCGGAGAATCAACTGGCAGTATAATCTCGAGATTATACTGCCAGTTGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-2335s21c2
Sequence:CCGGAGGGCACACTACACTATTAATCTCGAGATTAATAGTGTAGTGTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-545s21c2
Sequence:CCGGAGAAGTATGGAAGGATTATTACTCGAGTAATAATCCTTCCATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000414.2-1140s21c2
Sequence:CCGGTACGGAACTGGAAGCTATTATCTCGAGATAATAGCTTCCAGTTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)