EMAIL THIS PAGE TO A FRIEND

HSD17B6

hydroxysteroid (17-beta) dehydrogenase 6

49 Gene Product Result for
Synonyms: HSE RODH SDR9C6
UniProtKB ID: O14756, O43275
Gene ID:
Human(8630) Summary: The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. Transcript variants utilizing alternative polyadenylation signals exist. [provided by RefSeq, Jul 2008]
Mouse(27400) hydroxysteroid (17-beta) dehydrogenase 6
Rat(286964) hydroxysteroid (17-beta) dehydrogenase 6
naked mole-rat(101699287) hydroxysteroid (17-beta) dehydrogenase 6
cow(533086) hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)
domestic cat(101088341) hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)
dog(481118) hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122781 MISSION® esiRNA esiRNA human HSD17B6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003725 Rosetta Predictions human pricing
NM_173305 Rosetta Predictions rat pricing
NM_013786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054312 predicted 986
2 SASI_Hs01_00054314 predicted 815
3 SASI_Hs02_00336166 predicted 1128
4 SASI_Hs01_00054315 predicted 461
5 SASI_Hs01_00054316 predicted 666
6 SASI_Hs01_00054317 predicted 834
7 SASI_Hs01_00054318 predicted 1119
8 SASI_Hs01_00054319 predicted 433
9 SASI_Hs01_00054320 predicted 506
10 SASI_Hs01_00054321 predicted 803
11 SASI_Hs01_00054313 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113228 predicted 507
2 SASI_Rn01_00113229 predicted 962
3 SASI_Rn01_00113230 predicted 549
4 SASI_Rn01_00113231 predicted 737
5 SASI_Rn01_00113232 predicted 756
6 SASI_Rn01_00113233 predicted 601
7 SASI_Rn01_00113235 predicted 494
8 SASI_Rn01_00113236 predicted 821
9 SASI_Rn02_00269386 predicted 243
10 SASI_Rn02_00269387 predicted 1011
11 SASI_Rn01_00113234 predicted 765
12 SASI_Rn01_00113237 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180738 predicted 610
2 SASI_Mm01_00180739 predicted 841
3 SASI_Mm01_00180740 predicted 1181
4 SASI_Mm01_00180741 predicted 667
5 SASI_Mm01_00180742 predicted 529
6 SASI_Mm01_00180743 predicted 1233
7 SASI_Mm01_00180744 predicted 1093
8 SASI_Mm01_00180745 predicted 605
9 SASI_Mm01_00180746 predicted 207
10 SASI_Mm01_00180747 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003725
VALIDATED
HSD17B6 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-188s1c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003725.2-774s1c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-1317s1c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-869s1c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-447s1c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003725.2-1317s21c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-188s21c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-447s21c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-869s21c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-774s21c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003725
VALIDATED
HSD17B6 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-188s1c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003725.2-774s1c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-1317s1c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-869s1c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-447s1c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003725.2-1317s21c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-188s21c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-447s21c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-869s21c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-774s21c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003725
VALIDATED
HSD17B6 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-188s1c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003725.2-774s1c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-1317s1c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-869s1c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003725.2-447s1c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003725.2-1317s21c1
Sequence:CCGGGCCTTATTAAACAGAGTAGATCTCGAGATCTACTCTGTTTAATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-188s21c1
Sequence:CCGGCCTCCAAGACAAGTATGTCTTCTCGAGAAGACATACTTGTCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-447s21c1
Sequence:CCGGGCAGGCATTCTTACACCAATTCTCGAGAATTGGTGTAAGAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-869s21c1
Sequence:CCGGGCTGTTGAATTGTAGCACAAACTCGAGTTTGTGCTACAATTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003725.2-774s21c1
Sequence:CCGGCGAATGAAGCAAAGTTGGAAACTCGAGTTTCCAACTTTGCTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013786
HSD17B6 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-551s1c1
Sequence:CCGGGCCTACATTGAATGGTACAGACTCGAGTCTGTACCATTCAATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-952s1c1
Sequence:CCGGGTTGATGAAGTGTAGCAGGAACTCGAGTTCCTGCTACACTTCATCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-530s1c1
Sequence:CCGGGCAGGTGTGTTACAACCATTTCTCGAGAAATGGTTGTAACACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-1088s1c1
Sequence:CCGGGCGTCACTGGTAGACTACTTACTCGAGTAAGTAGTCTACCAGTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-670s1c1
Sequence:CCGGCGTCAATGTCTCCAGTGCTTTCTCGAGAAAGCACTGGAGACATTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013786
HSD17B6 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-551s1c1
Sequence:CCGGGCCTACATTGAATGGTACAGACTCGAGTCTGTACCATTCAATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-952s1c1
Sequence:CCGGGTTGATGAAGTGTAGCAGGAACTCGAGTTCCTGCTACACTTCATCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-530s1c1
Sequence:CCGGGCAGGTGTGTTACAACCATTTCTCGAGAAATGGTTGTAACACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-1088s1c1
Sequence:CCGGGCGTCACTGGTAGACTACTTACTCGAGTAAGTAGTCTACCAGTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-670s1c1
Sequence:CCGGCGTCAATGTCTCCAGTGCTTTCTCGAGAAAGCACTGGAGACATTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013786
HSD17B6 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-551s1c1
Sequence:CCGGGCCTACATTGAATGGTACAGACTCGAGTCTGTACCATTCAATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-952s1c1
Sequence:CCGGGTTGATGAAGTGTAGCAGGAACTCGAGTTCCTGCTACACTTCATCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-530s1c1
Sequence:CCGGGCAGGTGTGTTACAACCATTTCTCGAGAAATGGTTGTAACACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-1088s1c1
Sequence:CCGGGCGTCACTGGTAGACTACTTACTCGAGTAAGTAGTCTACCAGTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013786.2-670s1c1
Sequence:CCGGCGTCAATGTCTCCAGTGCTTTCTCGAGAAAGCACTGGAGACATTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)