EMAIL THIS PAGE TO A FRIEND

HSD17B7

hydroxysteroid (17-beta) dehydrogenase 7

50 Gene Product Result for
Synonyms: PRAP SDR37C1
UniProtKB ID: P56937, Q5T246, Q7Z4V9, Q8WWS2, Q9UF00
Gene ID:
Human(51478) Summary: HSD17B7 encodes an enzyme that functions both as a 17-beta-hydroxysteroid dehydrogenase (EC 1.1.1.62) in the biosynthesis of sex steroids and as a 3-ketosteroid reductase (EC 1.1.1.270) in the biosynthesis of cholesterol (Marijanovic et al., 2003 [PubMed 12829805]
Mouse(15490) hydroxysteroid (17-beta) dehydrogenase 7
Rat(29540) hydroxysteroid (17-beta) dehydrogenase 7
Zebrafish(768185) hydroxysteroid (17-beta) dehydrogenase 7
chicken(424367) hydroxysteroid (17-beta) dehydrogenase 7
cow(505212) hydroxysteroid (17-beta) dehydrogenase 7
domestic cat(101083482) hydroxysteroid (17-beta) dehydrogenase 7
dog(609364) hydroxysteroid (17-beta) dehydrogenase 7
sheep(101110013) hydroxysteroid (17-beta) dehydrogenase 7
Domestic Rabbit(100008778) hydroxysteroid (17-beta) dehydrogenase 7
domestic guinea pig(100729809) hydroxysteroid (17-beta) dehydrogenase 7
naked mole-rat(101712707) hydroxysteroid (17-beta) dehydrogenase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016371 Rosetta Predictions human pricing
NM_017235 Rosetta Predictions rat pricing
NM_010476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040817 predicted 467
2 SASI_Hs01_00040818 predicted 762
3 SASI_Hs01_00040819 predicted 827
4 SASI_Hs01_00040820 predicted 796
5 SASI_Hs01_00040821 predicted 368
6 SASI_Hs02_00349359 predicted 710
7 SASI_Hs02_00349360 predicted 810
8 SASI_Hs01_00040822 predicted 507
9 SASI_Hs01_00040823 predicted 423
10 SASI_Hs01_00040825 predicted 776
11 SASI_Hs01_00040824 predicted 864
12 SASI_Hs01_00040826 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084278 predicted 436
2 SASI_Rn01_00084279 predicted 419
3 SASI_Rn01_00084280 predicted 1083
4 SASI_Rn01_00084281 predicted 298
5 SASI_Rn01_00084282 predicted 337
6 SASI_Rn01_00084283 predicted 1115
7 SASI_Rn01_00084284 predicted 683
8 SASI_Rn01_00084285 predicted 875
9 SASI_Rn01_00084286 predicted 746
10 SASI_Rn01_00084287 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318687 predicted 688
2 SASI_Mm02_00318688 predicted 310
3 SASI_Mm02_00318689 predicted 355
4 SASI_Mm02_00318690 predicted 325
5 SASI_Mm02_00318691 predicted 394
6 SASI_Mm02_00318692 predicted 484
7 SASI_Mm02_00318693 predicted 528
8 SASI_Mm02_00318694 predicted 948
9 SASI_Mm02_00318695 predicted 1156
10 SASI_Mm02_00318696 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016371
VALIDATED
HSD17B7 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-816s21c1
Sequence:CCGGACGCTGTTGATGCCGGCAATACTCGAGTATTGCCGGCATCAACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-804s21c1
Sequence:CCGGCCGTTTATATGGACGCTGTTGCTCGAGCAACAGCGTCCATATAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-727s21c1
Sequence:CCGGTCAACCAGCAGGGTCTCTATTCTCGAGAATAGAGACCCTGCTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-319s21c1
Sequence:CCGGAGGAACTTAAGCAAAGGTTTCCTCGAGGAAACCTTTGCTTAAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-764s21c1
Sequence:CCGGAGGTACAGCATTGACCAATTTCTCGAGAAATTGGTCAATGCTGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-648s1c1
Sequence:CCGGCAGCAGGGTCTCTATTCCAATCTCGAGATTGGAATAGAGACCCTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-81s1c1
Sequence:CCGGGCGGAAGATGATGAGCTTCATCTCGAGATGAAGCTCATCATCTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-719s1c1
Sequence:CCGGTCCGTTTATATGGACGCTGTTCTCGAGAACAGCGTCCATATAAACGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-747s1c1
Sequence:CCGGGCAATATTGCTACTTCGCTTTCTCGAGAAAGCGAAGTAGCAATATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-687s1c1
Sequence:CCGGGCATTGACCAATTTGACATATCTCGAGATATGTCAAATTGGTCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016371
VALIDATED
HSD17B7 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-816s21c1
Sequence:CCGGACGCTGTTGATGCCGGCAATACTCGAGTATTGCCGGCATCAACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-804s21c1
Sequence:CCGGCCGTTTATATGGACGCTGTTGCTCGAGCAACAGCGTCCATATAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-727s21c1
Sequence:CCGGTCAACCAGCAGGGTCTCTATTCTCGAGAATAGAGACCCTGCTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-319s21c1
Sequence:CCGGAGGAACTTAAGCAAAGGTTTCCTCGAGGAAACCTTTGCTTAAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-764s21c1
Sequence:CCGGAGGTACAGCATTGACCAATTTCTCGAGAAATTGGTCAATGCTGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-648s1c1
Sequence:CCGGCAGCAGGGTCTCTATTCCAATCTCGAGATTGGAATAGAGACCCTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-81s1c1
Sequence:CCGGGCGGAAGATGATGAGCTTCATCTCGAGATGAAGCTCATCATCTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-719s1c1
Sequence:CCGGTCCGTTTATATGGACGCTGTTCTCGAGAACAGCGTCCATATAAACGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-747s1c1
Sequence:CCGGGCAATATTGCTACTTCGCTTTCTCGAGAAAGCGAAGTAGCAATATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-687s1c1
Sequence:CCGGGCATTGACCAATTTGACATATCTCGAGATATGTCAAATTGGTCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016371
VALIDATED
HSD17B7 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-816s21c1
Sequence:CCGGACGCTGTTGATGCCGGCAATACTCGAGTATTGCCGGCATCAACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-804s21c1
Sequence:CCGGCCGTTTATATGGACGCTGTTGCTCGAGCAACAGCGTCCATATAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-727s21c1
Sequence:CCGGTCAACCAGCAGGGTCTCTATTCTCGAGAATAGAGACCCTGCTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-319s21c1
Sequence:CCGGAGGAACTTAAGCAAAGGTTTCCTCGAGGAAACCTTTGCTTAAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016371.2-764s21c1
Sequence:CCGGAGGTACAGCATTGACCAATTTCTCGAGAAATTGGTCAATGCTGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-648s1c1
Sequence:CCGGCAGCAGGGTCTCTATTCCAATCTCGAGATTGGAATAGAGACCCTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-81s1c1
Sequence:CCGGGCGGAAGATGATGAGCTTCATCTCGAGATGAAGCTCATCATCTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-719s1c1
Sequence:CCGGTCCGTTTATATGGACGCTGTTCTCGAGAACAGCGTCCATATAAACGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016371.1-747s1c1
Sequence:CCGGGCAATATTGCTACTTCGCTTTCTCGAGAAAGCGAAGTAGCAATATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016371.1-687s1c1
Sequence:CCGGGCATTGACCAATTTGACATATCTCGAGATATGTCAAATTGGTCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010476
VALIDATED
HSD17B7 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-903s1c1
Sequence:CCGGCCTCAGGATTTGGGACTAATTCTCGAGAATTAGTCCCAAATCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-473s1c1
Sequence:CCGGCACTTTATTCTGATTCGGGAACTCGAGTTCCCGAATCAGAATAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-137s1c1
Sequence:CCGGGCGTGTAGGAACCTGAGTAAACTCGAGTTTACTCAGGTTCCTACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-316s1c1
Sequence:CCGGCCTGCCTAATCCACAATTCAACTCGAGTTGAATTGTGGATTAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-712s1c1
Sequence:CCGGCGTGATGACCAATATGACGTACTCGAGTACGTCATATTGGTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010476
VALIDATED
HSD17B7 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-903s1c1
Sequence:CCGGCCTCAGGATTTGGGACTAATTCTCGAGAATTAGTCCCAAATCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-473s1c1
Sequence:CCGGCACTTTATTCTGATTCGGGAACTCGAGTTCCCGAATCAGAATAAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-137s1c1
Sequence:CCGGGCGTGTAGGAACCTGAGTAAACTCGAGTTTACTCAGGTTCCTACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-316s1c1
Sequence:CCGGCCTGCCTAATCCACAATTCAACTCGAGTTGAATTGTGGATTAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-712s1c1
Sequence:CCGGCGTGATGACCAATATGACGTACTCGAGTACGTCATATTGGTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010476
VALIDATED
HSD17B7 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-903s1c1
Sequence:CCGGCCTCAGGATTTGGGACTAATTCTCGAGAATTAGTCCCAAATCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-473s1c1
Sequence:CCGGCACTTTATTCTGATTCGGGAACTCGAGTTCCCGAATCAGAATAAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-137s1c1
Sequence:CCGGGCGTGTAGGAACCTGAGTAAACTCGAGTTTACTCAGGTTCCTACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-316s1c1
Sequence:CCGGCCTGCCTAATCCACAATTCAACTCGAGTTGAATTGTGGATTAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010476.2-712s1c1
Sequence:CCGGCGTGATGACCAATATGACGTACTCGAGTACGTCATATTGGTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)