EMAIL THIS PAGE TO A FRIEND

HSD17B7P2

hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2

45 Gene Product Result for
Synonyms: HSD17B7 Hsd17b_2 bA291L22.1
Species: Human HSD17B7P2(158160)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031744 Rosetta Predictions human pricing
NR_003086 Rosetta Predictions human pricing
XR_042142 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013744 predicted 466
2 SASI_Hs01_00013745 predicted 694
3 SASI_Hs01_00013746 predicted 362
4 SASI_Hs01_00013747 predicted 366
5 SASI_Hs01_00013748 predicted 415
6 SASI_Hs01_00013749 predicted 290
7 SASI_Hs01_00013750 predicted 745
8 SASI_Hs01_00013751 predicted 648
9 SASI_Hs01_00013752 predicted 657
10 SASI_Hs01_00013753 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378116 predicted 453
2 SASI_Hs02_00378117 predicted 688
3 SASI_Hs02_00378118 predicted 285
4 SASI_Hs02_00378119 predicted 356
5 SASI_Hs02_00378120 predicted 361
6 SASI_Hs02_00378121 predicted 415
7 SASI_Hs02_00378122 predicted 742
8 SASI_Hs02_00378123 predicted 650
9 SASI_Hs02_00378124 predicted 655
10 SASI_Hs02_00378125 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533395 predicted 468
2 SASI_Hs02_00533396 predicted 360
3 SASI_Hs02_00533397 predicted 364
4 SASI_Hs02_00533398 predicted 419
5 SASI_Hs02_00533399 predicted 308
6 SASI_Hs02_00533400 predicted 605
7 SASI_Hs02_00533401 predicted 324
8 SASI_Hs02_00533402 predicted 656
9 SASI_Hs02_00533403 predicted 655
10 SASI_Hs02_00533404 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182829
HSD17B7P2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-356s1c1
Sequence:CCGGCATGCCTAATCCACAACTAAACTCGAGTTTAGTTGTGGATTAGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-721s1c1
Sequence:CCGGGTGCTGTATTCGTCTGTGTATCTCGAGATACACAGACGAATACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-575s1c1
Sequence:CCGGCATCTGGACATCATCTCGCAACTCGAGTTGCGAGATGATGTCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-384s1c1
Sequence:CCGGGCACTTCTCTTTGGCCTCTTTCTCGAGAAAGAGGCCAAAGAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-648s1c1
Sequence:CCGGGAACCCTACAGCTCTTCCAAACTCGAGTTTGGAAGAGCTGTAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182829.1-937s1c1
Sequence:CCGGCCACCACTGACTTTGGAAGAACTCGAGTTCTTCCAAAGTCAGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-664s1c1
Sequence:CCGGCCAAATATGCCACTGACCTTTCTCGAGAAAGGTCAGTGGCATATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-800s1c1
Sequence:CCGGGAGGCACTAAATCTTGGAGAACTCGAGTTCTCCAAGATTTAGTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-840s1c1
Sequence:CCGGGCATTCACTTTGACACCATATCTCGAGATATGGTGTCAAAGTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-940s1c1
Sequence:CCGGCCACTGACTTTGGAAGAAATTCTCGAGAATTTCTTCCAAAGTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182829
HSD17B7P2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-356s1c1
Sequence:CCGGCATGCCTAATCCACAACTAAACTCGAGTTTAGTTGTGGATTAGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-721s1c1
Sequence:CCGGGTGCTGTATTCGTCTGTGTATCTCGAGATACACAGACGAATACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-575s1c1
Sequence:CCGGCATCTGGACATCATCTCGCAACTCGAGTTGCGAGATGATGTCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-384s1c1
Sequence:CCGGGCACTTCTCTTTGGCCTCTTTCTCGAGAAAGAGGCCAAAGAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-648s1c1
Sequence:CCGGGAACCCTACAGCTCTTCCAAACTCGAGTTTGGAAGAGCTGTAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182829.1-937s1c1
Sequence:CCGGCCACCACTGACTTTGGAAGAACTCGAGTTCTTCCAAAGTCAGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-664s1c1
Sequence:CCGGCCAAATATGCCACTGACCTTTCTCGAGAAAGGTCAGTGGCATATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-800s1c1
Sequence:CCGGGAGGCACTAAATCTTGGAGAACTCGAGTTCTCCAAGATTTAGTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-840s1c1
Sequence:CCGGGCATTCACTTTGACACCATATCTCGAGATATGGTGTCAAAGTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-940s1c1
Sequence:CCGGCCACTGACTTTGGAAGAAATTCTCGAGAATTTCTTCCAAAGTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182829
HSD17B7P2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-356s1c1
Sequence:CCGGCATGCCTAATCCACAACTAAACTCGAGTTTAGTTGTGGATTAGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-721s1c1
Sequence:CCGGGTGCTGTATTCGTCTGTGTATCTCGAGATACACAGACGAATACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-575s1c1
Sequence:CCGGCATCTGGACATCATCTCGCAACTCGAGTTGCGAGATGATGTCCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182829.1-384s1c1
Sequence:CCGGGCACTTCTCTTTGGCCTCTTTCTCGAGAAAGAGGCCAAAGAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-648s1c1
Sequence:CCGGGAACCCTACAGCTCTTCCAAACTCGAGTTTGGAAGAGCTGTAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182829.1-937s1c1
Sequence:CCGGCCACCACTGACTTTGGAAGAACTCGAGTTCTTCCAAAGTCAGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182829.1-664s1c1
Sequence:CCGGCCAAATATGCCACTGACCTTTCTCGAGAAAGGTCAGTGGCATATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-800s1c1
Sequence:CCGGGAGGCACTAAATCTTGGAGAACTCGAGTTCTCCAAGATTTAGTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-840s1c1
Sequence:CCGGGCATTCACTTTGACACCATATCTCGAGATATGGTGTCAAAGTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182829.1-940s1c1
Sequence:CCGGCCACTGACTTTGGAAGAAATTCTCGAGAATTTCTTCCAAAGTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)