EMAIL THIS PAGE TO A FRIEND

HSD17B8

hydroxysteroid (17-beta) dehydrogenase 8

56 Gene Product Result for
Synonyms: D6S2245E FABG FABGL H2-KE6 HKE6 KE6 RING2 SDR30C1 dJ1033B10.9
UniProtKB ID: Q92506, A6NLX7, Q5STP7, Q9UIQ1
Gene ID:
Human(7923) Summary: In mice, the Ke6 protein is a 17-beta-hydroxysteroid dehydrogenase that can regulate the concentration of biologically active estrogens and androgens. It is preferentially an oxidative enzyme and inactivates estradiol, testosterone, and dihydrotestosterone. However, the enzyme has some reductive activity and can synthesize estradiol from estrone. The protein encoded by this gene is similar to Ke6 and is a member of the short-chain dehydrogenase superfamily. An alternatively spliced transcript of this gene has been detected, but the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
Rat(361802) hydroxysteroid (17-beta) dehydrogenase 8
Zebrafish(64815) hydroxysteroid (17-beta) dehydrogenase 8
dog(607895) hydroxysteroid (17-beta) dehydrogenase 8
domestic cat(101086309) hydroxysteroid (17-beta) dehydrogenase 8
cow(532422) hydroxysteroid (17-beta) dehydrogenase 8
domestic guinea pig(100736228) hydroxysteroid (17-beta) dehydrogenase 8
naked mole-rat(101726130) hydroxysteroid (17-beta) dehydrogenase 8
sheep(101116612) hydroxysteroid (17-beta) dehydrogenase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014234 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108061 MISSION® esiRNA esiRNA human AL844527.6-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014234 Rosetta Predictions human pricing
NM_212529 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109762 predicted 592
2 SASI_Hs01_00109763 predicted 550
3 SASI_Hs01_00109764 predicted 386
4 SASI_Hs01_00109765 predicted 758
5 SASI_Hs01_00109766 predicted 232
6 SASI_Hs01_00109767 predicted 392
7 SASI_Hs01_00109768 predicted 436
8 SASI_Hs02_00345270 predicted 535
9 SASI_Hs01_00109769 predicted 617
10 SASI_Hs01_00109770 predicted 866
11 SASI_Hs01_00109771 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055600 predicted 534
2 SASI_Rn01_00055601 predicted 569
3 SASI_Rn01_00055602 predicted 268
4 SASI_Rn01_00055603 predicted 505
5 SASI_Rn01_00055604 predicted 330
6 SASI_Rn01_00055605 predicted 641
7 SASI_Rn01_00055606 predicted 317
8 SASI_Rn01_00055607 predicted 655
9 SASI_Rn01_00055608 predicted 644
10 SASI_Rn01_00055609 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014234
VALIDATED
HSD17B8 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-525s1c1
Sequence:CCGGGACAAACTATGCAGCATCCAACTCGAGTTGGATGCTGCATAGTTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014234.3-678s1c1
Sequence:CCGGGATTACTGAAATGATCCCGATCTCGAGATCGGGATCATTTCAGTAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-785s1c1
Sequence:CCGGTGGAAGTCACTGGAGGTCTTTCTCGAGAAAGACCTCCAGTGACTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-468s1c1
Sequence:CCGGTCGTGGTTCCATCATCAACATCTCGAGATGTTGATGATGGAACCACGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-486s1c1
Sequence:CCGGCATCAGTAGCATCGTAGGAAACTCGAGTTTCCTACGATGCTACTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-341s21c1
Sequence:CCGGGCATCACCCAGGATGAGTTTCCTCGAGGAAACTCATCCTGGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-591s21c1
Sequence:CCGGACGACATGGGATCCGCTGTAACTCGAGTTACAGCGGATCCCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-539s21c1
Sequence:CCGGCATCCAAGGCTGGAGTGATTGCTCGAGCAATCACTCCAGCCTTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-669s21c1
Sequence:GTACCGGGGTGGACAAGATTACTGAAATCTCGAGATTTCAGTAATCTTGTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-635s21c1
Sequence:CCGGCAACACCCATGACACAGAAAGCTCGAGCTTTCTGTGTCATGGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014234
VALIDATED
HSD17B8 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-525s1c1
Sequence:CCGGGACAAACTATGCAGCATCCAACTCGAGTTGGATGCTGCATAGTTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014234.3-678s1c1
Sequence:CCGGGATTACTGAAATGATCCCGATCTCGAGATCGGGATCATTTCAGTAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-785s1c1
Sequence:CCGGTGGAAGTCACTGGAGGTCTTTCTCGAGAAAGACCTCCAGTGACTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-468s1c1
Sequence:CCGGTCGTGGTTCCATCATCAACATCTCGAGATGTTGATGATGGAACCACGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-486s1c1
Sequence:CCGGCATCAGTAGCATCGTAGGAAACTCGAGTTTCCTACGATGCTACTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-341s21c1
Sequence:CCGGGCATCACCCAGGATGAGTTTCCTCGAGGAAACTCATCCTGGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-591s21c1
Sequence:CCGGACGACATGGGATCCGCTGTAACTCGAGTTACAGCGGATCCCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-539s21c1
Sequence:CCGGCATCCAAGGCTGGAGTGATTGCTCGAGCAATCACTCCAGCCTTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-669s21c1
Sequence:GTACCGGGGTGGACAAGATTACTGAAATCTCGAGATTTCAGTAATCTTGTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-635s21c1
Sequence:CCGGCAACACCCATGACACAGAAAGCTCGAGCTTTCTGTGTCATGGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014234
VALIDATED
HSD17B8 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-525s1c1
Sequence:CCGGGACAAACTATGCAGCATCCAACTCGAGTTGGATGCTGCATAGTTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014234.3-678s1c1
Sequence:CCGGGATTACTGAAATGATCCCGATCTCGAGATCGGGATCATTTCAGTAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-785s1c1
Sequence:CCGGTGGAAGTCACTGGAGGTCTTTCTCGAGAAAGACCTCCAGTGACTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-468s1c1
Sequence:CCGGTCGTGGTTCCATCATCAACATCTCGAGATGTTGATGATGGAACCACGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014234.3-486s1c1
Sequence:CCGGCATCAGTAGCATCGTAGGAAACTCGAGTTTCCTACGATGCTACTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-341s21c1
Sequence:CCGGGCATCACCCAGGATGAGTTTCCTCGAGGAAACTCATCCTGGGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-591s21c1
Sequence:CCGGACGACATGGGATCCGCTGTAACTCGAGTTACAGCGGATCCCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-539s21c1
Sequence:CCGGCATCCAAGGCTGGAGTGATTGCTCGAGCAATCACTCCAGCCTTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-669s21c1
Sequence:GTACCGGGGTGGACAAGATTACTGAAATCTCGAGATTTCAGTAATCTTGTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014234.3-635s21c1
Sequence:CCGGCAACACCCATGACACAGAAAGCTCGAGCTTTCTGTGTCATGGGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)