EMAIL THIS PAGE TO A FRIEND

HSD3B1

hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

87 Gene Product Result for
Synonyms: 3BETAHSD HSD3B HSDB3 HSDB3A I SDR11E1
UniProtKB ID: P14060, A8K691, Q14545, Q8IV65
Gene ID:
Mouse(15492) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Rat(360348) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
domestic guinea pig(100379573) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
naked mole-rat(101707488) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
sheep(100190978) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Zebrafish(373131) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Horse(100034078) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
domestic cat(100616070) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
cow(281824) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F1293 Finasteride ≥98% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000862 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU222731 MISSION® esiRNA esiRNA targeting human HSD3B1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000862 Rosetta Predictions human pricing
NM_001007719 Rosetta Predictions rat pricing
XM_579404 Rosetta Predictions rat pricing
NM_008293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046915 predicted 797
2 SASI_Hs01_00046917 predicted 714
3 SASI_Hs02_00303381 predicted 557
4 SASI_Hs02_00303382 predicted 998
5 SASI_Hs02_00303383 predicted 787
6 SASI_Hs02_00303384 predicted 788
7 SASI_Hs02_00303385 predicted 1047
8 SASI_Hs02_00303386 predicted 795
9 SASI_Hs02_00303387 predicted 593
10 SASI_Hs02_00303388 predicted 1105
11 SASI_Hs01_00046916 predicted 721
12 SASI_Hs01_00046918 predicted 1108
13 SASI_Hs01_00046919 predicted 489
14 SASI_Hs01_00046920 predicted 1254
15 SASI_Hs01_00046921 predicted 1147
16 SASI_Hs01_00046922 predicted 804
17 SASI_Hs01_00046923 predicted 1068
18 SASI_Hs01_00046924 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099459 predicted 457
2 SASI_Rn01_00099460 predicted 1255
3 SASI_Rn01_00099461 predicted 1278
4 SASI_Rn01_00099462 predicted 393
5 SASI_Rn01_00099463 predicted 948
6 SASI_Rn01_00099464 predicted 461
7 SASI_Rn01_00099465 predicted 314
8 SASI_Rn01_00099466 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147400 predicted 459
2 SASI_Rn01_00147401 predicted 1264
3 SASI_Rn01_00147402 predicted 1285
4 SASI_Rn01_00147403 predicted 399
5 SASI_Rn01_00147404 predicted 951
6 SASI_Rn01_00147405 predicted 471
7 SASI_Rn01_00147406 predicted 315
8 SASI_Rn01_00147407 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059736 predicted 689
2 SASI_Mm01_00059737 predicted 1337
3 SASI_Mm01_00059738 predicted 1295
4 SASI_Mm01_00059739 predicted 968
5 SASI_Mm01_00059740 predicted 1307
6 SASI_Mm01_00059741 predicted 476
7 SASI_Mm01_00059742 predicted 917
8 SASI_Mm01_00059743 predicted 1595
9 SASI_Mm01_00059744 predicted 1508
10 SASI_Mm01_00059745 predicted 1517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008293
HSD3B1 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008293.3-1442s21c1
Sequence:CCGGGGATAGGGACAATAGTGGAACCTCGAGGTTCCACTATTGTCCCTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-236s1c1
Sequence:CCGGGACAAAGTATTCCGACCAGAACTCGAGTTCTGGTCGGAATACTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1096s1c1
Sequence:CCGGGTCAAATAGCACGTTCACTTTCTCGAGAAAGTGAACGTGCTATTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-680s1c1
Sequence:CCGGGCCTTAAGACCCATGTACATTCTCGAGAATGTACATGGGTCTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-554s1c1
Sequence:CCGGCACGAGGAACAGAATCATGAACTCGAGTTCATGATTCTGTTCCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1054s1c1
Sequence:CCGGCTACAGGTATAGACCTCTCTTCTCGAGAAGAGAGGTCTATACCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008293
HSD3B1 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008293.3-1442s21c1
Sequence:CCGGGGATAGGGACAATAGTGGAACCTCGAGGTTCCACTATTGTCCCTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-236s1c1
Sequence:CCGGGACAAAGTATTCCGACCAGAACTCGAGTTCTGGTCGGAATACTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1096s1c1
Sequence:CCGGGTCAAATAGCACGTTCACTTTCTCGAGAAAGTGAACGTGCTATTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-680s1c1
Sequence:CCGGGCCTTAAGACCCATGTACATTCTCGAGAATGTACATGGGTCTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-554s1c1
Sequence:CCGGCACGAGGAACAGAATCATGAACTCGAGTTCATGATTCTGTTCCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1054s1c1
Sequence:CCGGCTACAGGTATAGACCTCTCTTCTCGAGAAGAGAGGTCTATACCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008293
HSD3B1 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008293.3-1442s21c1
Sequence:CCGGGGATAGGGACAATAGTGGAACCTCGAGGTTCCACTATTGTCCCTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-236s1c1
Sequence:CCGGGACAAAGTATTCCGACCAGAACTCGAGTTCTGGTCGGAATACTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1096s1c1
Sequence:CCGGGTCAAATAGCACGTTCACTTTCTCGAGAAAGTGAACGTGCTATTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-680s1c1
Sequence:CCGGGCCTTAAGACCCATGTACATTCTCGAGAATGTACATGGGTCTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-554s1c1
Sequence:CCGGCACGAGGAACAGAATCATGAACTCGAGTTCATGATTCTGTTCCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008293.1-1054s1c1
Sequence:CCGGCTACAGGTATAGACCTCTCTTCTCGAGAAGAGAGGTCTATACCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000862
HSD3B1 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000862.2-1120s21c1
Sequence:CCGGCGTATTCACCTTCTCTTATAACTCGAGTTATAAGAGAAGGTGAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000862.2-1451s21c1
Sequence:CCGGGAAGGTTTCTGTCCTAATCATCTCGAGATGATTAGGACAGAAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-679s1c1
Sequence:CCGGGTGCCTTACGACCCATGTATACTCGAGTATACATGGGTCGTAAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-911s1c1
Sequence:CCGGGCCTCACCAAAGCTATGATAACTCGAGTTATCATAGCTTTGGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-786s1c1
Sequence:CCGGTCCACTGTTAACCCAGTCTATCTCGAGATAGACTGGGTTAACAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-1082s1c1
Sequence:CCGGCCACATAGTCACATTGTCAAACTCGAGTTTGACAATGTGACTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000862
HSD3B1 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000862.2-1120s21c1
Sequence:CCGGCGTATTCACCTTCTCTTATAACTCGAGTTATAAGAGAAGGTGAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000862.2-1451s21c1
Sequence:CCGGGAAGGTTTCTGTCCTAATCATCTCGAGATGATTAGGACAGAAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-679s1c1
Sequence:CCGGGTGCCTTACGACCCATGTATACTCGAGTATACATGGGTCGTAAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-911s1c1
Sequence:CCGGGCCTCACCAAAGCTATGATAACTCGAGTTATCATAGCTTTGGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-786s1c1
Sequence:CCGGTCCACTGTTAACCCAGTCTATCTCGAGATAGACTGGGTTAACAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-1082s1c1
Sequence:CCGGCCACATAGTCACATTGTCAAACTCGAGTTTGACAATGTGACTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000862
HSD3B1 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000862.2-1120s21c1
Sequence:CCGGCGTATTCACCTTCTCTTATAACTCGAGTTATAAGAGAAGGTGAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000862.2-1451s21c1
Sequence:CCGGGAAGGTTTCTGTCCTAATCATCTCGAGATGATTAGGACAGAAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-679s1c1
Sequence:CCGGGTGCCTTACGACCCATGTATACTCGAGTATACATGGGTCGTAAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-911s1c1
Sequence:CCGGGCCTCACCAAAGCTATGATAACTCGAGTTATCATAGCTTTGGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-786s1c1
Sequence:CCGGTCCACTGTTAACCCAGTCTATCTCGAGATAGACTGGGTTAACAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000862.1-1082s1c1
Sequence:CCGGCCACATAGTCACATTGTCAAACTCGAGTTTGACAATGTGACTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)